جلد 15، شماره 3 - ( 3-1395 )                   جلد 15 شماره 3 صفحات 287-292 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Naseri Arzanagh F, Morovvati S. A survey on Relationship Between Progesterone Receptor Gene Polymorphisms and Recurrent Spontaneous Abortions: A Short Report. JRUMS. 2016; 15 (3) :287-292
URL: http://journal.rums.ac.ir/article-1-2305-fa.html
ناصری ارزنق فاطمه، مروتی سعید. بررسی ارتباط پلی‌مورفیسم ژن گیرنده پروژسترون با سقط مکرر خودبه‌خودی: یک گزارش کوتاه. مجله دانشگاه علوم پزشکی رفسنجان. 1395; 15 (3) :287-292

URL: http://journal.rums.ac.ir/article-1-2305-fa.html


متن کامل [PDF 237 kb]   (723 دریافت)     |   چکیده (HTML)  (918 مشاهده)
متن کامل:   (120 مشاهده)
گزارش کوتاه

مجله دانشگاه علوم پزشکی رفسنجان

دوره 15، خرداد 1395، 292-287

بررسی ارتباط پلی‌مورفیسم ژن گیرنده پروژسترون با سقط مکرر خودبه‌خودی: یک گزارش کوتاه

فاطمه ناصری ارزنق[1]، دکتر سعید مروتی[2]

دریافت مقاله: 5/7/94        ارسال مقاله به نویسنده جهت اصلاح: 1/9/94      دریافت اصلاحیه از نویسنده: 2/12/94      پذیرش مقاله: 19/12/94

چکیده

زمینه و هدف: سقط‌های مکرر خودبه‌خودی به عنوان یک رویداد تکرارپذیر از دو یا بیشتر سقط قبل از هفته 20 تعریف می‌شود. در سقط مکرر به عنوان یک بیماری چندعاملی مسائل متعددی دخیل است و نقص ژنتیکی به عنوان یکی از عوامل عمده خطر برای سقط مکرر مطرح می‌باشد. به نظر می‌رسد وجود پلی‌مورفیسم در ژن گیرنده پروژسترون یکی از عوامل ژنتیکی دخیل در وقوع سقط مکرر باشد. هدف از این مطالعه، بررسی ارتباط پلی‌مورفیسم ژن گیرنده پروژسترون با سقط مکرر می‌باشد.

مواد و روش‌ها: در این مطالعه مقطعی 50 زن با سابقه سقط مکرر خودبه‌خودی با علت نامشخص به عنوان گروه بیمار و 50 زن بدون سابقه سقط مکرر و دارای حداقل 2 باروری موفق به عنوان گروه شاهد انتخاب شدند. برای بررسی پلی‌مورفیسم‌های G1031C و G1978T در ژن گیرنده پروژسترون از تکنیک ARMS-PCR استفاده شد. داده‌ها با استفاده از آزمون مجذور کای و آزمون دقیق فیشر مورد تجزیه و تحلیل قرار گرفتند.

یافته‌ها: برای پلی‌مورفیسم G1031C فراوانی آلل‌های GG، CC و GC به ترتیب در افراد گروه کنترل 72%، 6% و 22% و در افراد گروه بیمار 54%، 16% و 30% بود (008/0=p). برای پلی‌مورفیسم G1978T نیز فراوانی آلل‌های GG، TT و GT به ترتیب در افراد گروه کنترل 76%، 0% و 24% و در افراد بیمار 70%، 2% و 28% مشاهده شد که اختلاف در مورد این پلی‌مورفیسم در دو گروه معنی‌دار نبود.

نتیجه‌گیری: پلی‌مورفیسمG1031C  ممکن است با وقوع سقط مکرر مرتبط باشد اما ارتباطی بین پلی‌مورفیسمG1978T   و ایجاد سقط مکرر در جمعیت مورد مطالعه یافت نگردید. بنابراین مطالعه پلی‌مورفیسم G1031C در جمعیت‌های بزرگتر ممکن است تأیید کننده آن به عنوان مارکر تشخیصی در استعداد ابتلاء به سقط مکرر باشد.

واژه‌های کلیدی: چند‌‌ ‌‌شکلی تک نوکلئوتیدی، پلی‌مورفیسم، ژن گیرنده پروژسترون، سقط‌های مکرر خودبه‌خودی

 

مقدمه

سقط‌های مکرر خودبه‌خودی به عنوان یک رویداد تکرارپذیر از دو یا بیشتر سقط قبل از هفته 20 تعریف می‌شود] 1[. این سقط‌ها به دو دسته اولیه و ثانویه تقسیم می‌شوند. در سقط‌های مکرر اولیه، هیچ‌گاه بارداری موفقیت‌آمیز روی نداده است ولی در موارد ثانویه پس از یک تولد زنده سقط‌های مکرر روی می‌دهد ]2[. علائم سقط عبارتند از: تهوع، تورم سینه، خونریزی و یا لکه‌بینی که هر لحظه شدیدتر می‌شود، خروج لخته‌های بزرگ و غلیظ خون از بدن و درد و گرگرفتگی قسمت انتهایی و تحتانی شکم .علل سقط جنین عبارتند از حالات غیرطبیعی شکل رحم، اشکالات سیستم ایمنی، مشکلات هورمونی، نواقص آناتومیک و آندومتریوز، سن مادر، عوامل محیطی، عفونت‌ها، بیماری‌های مادر و اختلالات کروموزومی و ژنتیکی] 3[.

بیشترین علت سقط در سه ماهه اول بارداری، اختلالات کروموزومی است ]5-4[. برخی علل ژنتیکی سقط‌های مکرر عبارتند از موتاسیون در ژن‌های منفرد، اختلالات چند ژنی، فاکتورهای سیتوژنتیکی، پلی‌مورفیسم‌های نوکلئوتیدهای منفرد در ژن‌های مختلف از جمله ژن گیرنده هورمون پروژسترون ]7-6[.

پروژسترون یکی از هورمون‌های جنسی زنانه است. این هورمون یک استروئید بیست و یک کربنه می‌باشد که عمدتاً در تخمدان‌ها، جفت، مغز و غدد آدرنال تولید می‌شود و نقش اساسی در جلوگیری از سقط جنین ایفا می‌کند. لذا اختلال در عملکرد این هورمون می‌تواند اثرات جدی در سقط‌های خودبه‌خودی داشته باشد. اثر فیزیولوژیک پروژسترون با میانجی‌گری رسپتورهای پروژسترون می‌باشد ]9-8[. برخی مطالعات نشان داده‌اند وجود تعدادی از پلی‌مورفیسم‌های ژن رسپتور پروژسترون در سقط جنین اثر دارد ]12-10[.

به دلیل نقش و اهمیت پروژسترون و ژن گیرنده آن در ایجاد سقط مکرر، ارتباط دو مورد از مهم‌ترین پلی‌مورفیسم‌های این ژن شامل G1978T و G1031C با وقوع سقط‌های مکرر خودبه‌خودی در مطالعات مختلف مورد بررسی قرار گرفته است ]12-10[. از آنجا که مطالعات مذکور با نتایج متناقضی همراه بوده‌اند و نیز به‌دلیل آنکه در کشور ما مطالعه‌ای در این خصوص انجام نگرفته است، در این مطالعه به بررسی ارتباط این دو پلی‌مورفیسم با وقوع سقط مکرر خودبه‌خودی پرداخته شده است

مواد و روش‌ها

مطالعه مقطعی حاضر شامل یک جامعه 100 نفری متشکل از دو گروه از زنان است. یک گروه شامل 50 زن با سابقه سقط مکرر و گروه دیگر شامل 50 زن بدون سابقه سقط مکرر و دارای حداقل 2 باروری موفق به عنوان گروه شاهد که از میان مراجعه‌کنندگان به بیمارستان الزهرا و آیت ا... طالقانی و جهاد کشاورزی تبریز در سال 1391 انتخاب شدند.

برای بررسی پلی‌مورفیسم‌های G1031C (Ser344Thr)و G1978T (Leu660Val) در ژن گیرنده پروژسترون از واکنش زنجیره‌ای ARMS-PCR استفاده گردید ]13[. از همه این زنان نمونه خون گرفته شد و سپس استخراج  DNA از نمونه‌های خون انجام گردید. سقط‌های غیرخودبه‌خودی و سقط‌های مکرر خودبه‌خودی ناشی از ناهنجاری‌های کروموزومی در جنین، مشکلات آناتومیک در رحم و عفونت‌های مرتبط با سقط به عنوان معیارهای خروج از مطالعه در نظر گرفته شدند. بعد از خون‌گیری از ورید، خون را داخل لوله حاوی EDTA ریخته و با استفاده از کیت استخراج DNA شرکتGen ALL  ساخت کره جنوبی و مطابق دستورالعمل مربوطه DNA تمامی نمونه‌ها استخراج شد.

شناسایی پلی‌مورفیسم‌های ژن گیرنده پروژسترون با کمک سه پرایمر F، R1 و R2 برای هر یک از دو پلی‌مورفیسم صورت گرفت. توالی این پرایمرها و اندازه محصول PCR در هر کدام در جدول 1 آمده است. واکنش PCR  در حجم 25 میکرولیتر شامل ماسترمیکس میکرولیتر 9، پرایمرهای اختصاصی هر یک به میزان 1 میکرولیتر ،  DNA به میزان 1 میکرولیتر و آب مقطر  13 میکرولیتر بود. سپس واکنش PCR طی سیکل‌های زیر انجام شد: برای پلی‌مورفیسمG1031C (Ser344Thr)  سیکل ابتدایی دناتوره در دمای 95 درجه سانتی‌گراد به مدت 5 دقیقه، سپس 35 سیکل دناتوره در دمای 95 درجه سانتی‌گراد به مدت 30 ثانیه،  آنیلینگ در دمای 64 درجه سانتی‌گراد به مدت 45 ثانیه و اکستنشن در دمای 72 درجه سانتی‌گراد به مدت 1 دقیقه و در آخر سیکل نهایی اکستنشن در دمای 72 درجه سانتی‌گراد به مدت 5 دقیقه انجام شد. برای پلی‌مورفیسم G1978T (Val660Leu) همین شرایط با این تفاوت که دمای آنیلینگ برای این پلی‌مورفیسم °C62 در نظر گرفته شد. سپس محصولPCR  جهت بررسی نتایج بر روی ژل آگارز 1%  الکتروفورز شد.

داده‌ها به کمک نرم‌افزار SPSS نسخه 16 و با استفاده از آزمون مجذور کای و آزمون دقیق فیشر مورد تجزیه و تحلیل قرار گرفت. سطح معنی‌داری در آزمون‌ها 05/0 در نظر گرفته شد.

جدول1- توالی پرایمرهای مورد استفاده و اندازه محصول PCR در مورد هر یک از پلی‌مورفیسم‌ها

Product Size

Sequences 5΄→3΄

Primers

SNP

373bp

GCTCTGAGTCCGAGGAGTCTG

F

G1031C (Ser344Thr)

GACGAGGCACAGGGTGAAC

R1

GACGAGGCACAGGGTGAAG

R2

208bp

CATTCGATTGATGCTAAAATGC

F

G1978T (Val660Leu)

TTCATTTGGAACGCCCAC

R1

TTCATTTGGAACGCCCAA

R2

نتایج

در جمعیت مورد بررسی، میانگین و انحراف معیار سنی زنان گروه شاهد 43/1±54/25 و زنان گروه بیمار 98/1±08/26 سال بود. این تفاوت بر اساس آزمون t مستقل در دو گروه شاهد و بیمار تفاوت معنی‌داری را نشان نداد (122/0=p).

برای پلی‌مورفیسم G1031C (Ser344Thr) درصد آلل GG، CC و GC به ترتیب در گروه کنترل 72%، 6% و 22% و در گروه بیمار 54%، 16% و 30% بود (008/0=p). برای پلی‌‌مورفیسم G1978T (Leu660Val) درصد آلل GG، TT و GT به ترتیب در گروه کنترل 76%، 0% و 24% و در گروه بیمار70% ، 2% و 28% بود (510/0=p).

بحث

ژن گیرنده پروژسترون نقش مهم و حیاتی در دستگاه تولید مثل زنان بازی می‌کند ]14[. لذا پلی‌مورفیسم‌های این ژن می‌تواند در عملکرد گیرنده پروژسترون تأثیر داشته باشد.

 Schweikert و همکارانش در 42 بیمار مبتلا به سقط مکرر و 40 زن سالم به عنوان گروه کنترل وجود سه پلی‌مورفیسم G1031C در اگزون 1، G1978T در اگزون 4 و C2310T در اگزون 5 را مورد مطالعه قرار دادند. نتایج حاصل از بررسی آنان نشان داد که وجود این پلی‌مورفیسم‌ها با افزایش سقط مرتبط است ]10[.

در هند Aruna و همکارانش یک گروه متشکل از 143 زن با سابقه سقط مکرر و 150 نفر گروه کنترل بدون داشتن سابقه سقط را مورد بررسی قرار دادند. در مطالعه مذکور وجود 3 پلی‌مورفیسم G1031C در اگزون 1، G1978T در اگزون 4 و C2310T در اگزون 5 از ژن گیرنده پروژسترون مورد بررسی قرار گرفت. نتایج حاصل از این تحقیق ارتباط معنی‌داری بین پلی‌مورفیسم‌های مذکور و سقط مکرر نشان نداد ]11[.

در تایوان Su و همکارانش یک گروه 121 نفری از زنانی که سابقه حداقل 2 سقط جنین را داشتند و 179 نفر گروه کنترل را از نظر وجود دو پلی‌مورفیسم G1978T و G1031C در ژن گیرنده پروژسترون مورد بررسی قرار دادند. نتایج حاصل از این تحقیق ارتباط معنی‌داری بین پلی‌مورفیسم G1978T و وقوع سقط مکرر نشان داد اما میان پلی‌مورفیسم G1031C و وقوع سقط مکرر ارتباط معنی‌داری یافت نگردید ]12[.

در مطالعه حاضر بین وقوع سقط مکرر و پلی‌مورفیسم G1031C ارتباط معنی‌دار یافت شد ولی ارتباط مذکور با پلی‌مورفیسم G1978T از نظر آماری معنی‌دار نبود. به‌نظر می‌رسد تفاوت در نتایج حاصل از مطالعات مختلف ناشی از تفاوت‌های ژنتیکی در جمعیت‌های مختلف باشد. در این مطالعه به‌ دلیل محدودیت‌های بودجه‌ای و نیز عدم دسترسی به بیماران بیشتر در مدت زمان انجام طرح امکان بررسی بر روی تعداد بیشتری از افراد بیمار و کنترل میسر نگردید ولی پیشنهاد می‌گردد برای تأیید ارتباط یافت شده در این تحقیق، مطالعه بر روی جمعیت بزرگتری از بیماران و افراد کنترل انجام پذیرد.

نتیجه‌گیری

پلی‌مورفیسم G1031C ممکن است با وقوع سقط مکرر مرتبط باشد، اما ارتباط بین پلی‌مورفیسم G1978T و ایجاد سقط مکرر در جمعیت مورد مطالعه، معنی‌دار نبود. بنابراین، مطالعه پلی‌مورفیسم G1031C در جمعیت‌های بزرگتر ممکن است تأیید کننده آن به عنوان مارکر تشخیصی در استعداد ابتلاء به سقط مکرر باشد.

تشکر و قدردانی

بدین وسیله از اساتید و کارشناسان گرامی مرکز تحقیقات ژنتیک انسانی دانشگاه علوم پزشکی بقیه‌الله(عج) که در مراحل آزمایشگاهی طرح با مجریان طرح همکاری صمیمانه‌ای داشته‌اند و هم‌چنین از زنان شرکت‌کننده در این مطالعه تشکر و قدردانی می‌گردد.

 

References

  1. Ford HB, Schust DJ. Recurrent pregnancy loss: etiology, diagnosis, and therapy. Rev Obstet Gynecol 2009; 2(2): 76-83.
  2. Bulletti C, Flamigni C, Giacomucci E. Reproductive failure due to spontaneous abortion and recurrent miscarriage. Hum Reprod Update 1996; 2(2): 118-36.
  3. Chan RL, Olshan AF, Savitz DA, Herring AH, Daniels JL, Peterson HB, et. al. Severity and duration of nausea and vomiting symptoms in pregnancy and spontaneous abortion. Hum Reprod 2010; 25(11): 2907-12.
  4. The cytokine network during embryo_ implantation. Chang Gung Med J 2006; 29(1): 25-36.
  5. Roland L, Gagne A, Belanger MC, Boutet M, Julien P, Bilodeau JF. Plasma interleukin-18 (IL-18) levels are correlated with antioxidant vitamin coenzyme Q(10) in preeclampsia. Acta Obstet Gynecol Scand  2010; 89(3): 360-6.
  6. Sierra S, Stephenson M. Genetics of recurrent pregnancy loss. Semin Reprod Med 2006; 24(1): 17-24.
  7. Meka A, Reddy M. Recurrent Spontaneous abortions: an overview of genetic and nongenetic backgrounds. Int J Hum Genet 2006; 6(2): 109–17.
  8. Clarke CL, Sutherland RL. Progestin regulation of cellular proliferation. Endocr Rev 1990; 11(2): 266-301.
  9. Pepe GJ, Albrecht ED. Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev 1995; 16(5): 608-48.
  10.  Schweikert A, Rau T, Berkholz A, Allera A, Daufeldt S, Wildt L. Association of progesterone receptor polymorphism with recurrent abortions. Eur J Obstet Gynecol Reprod Biol  2004; 113(1): 67-72.
  11.  Aruna M, Nagaraja T, Andal S, Tarakeswari S, Sirisha PV, Reddy AG, et. al. Role of progesterone receptor polymorphisms in the recurrent spontaneous abortions: Indian case. PLoS One 2010; 5(1): e8712.
  12.  Su MT, Lee IW, Chen YC, Kuo PL. Association of progesterone receptor polymorphism with idiopathic recurrent pregnancy loss in Taiwanese Han population. J Assist Reprod Genet 2011; 28(3): 239-43.
  13.  Ye S, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 2001; 29(17): E88-8.

[14] Pfeiffer KA, Fimmers R, Engels G, van der Ven H, van der Ven K. The HLA-G genotype is potentially associated with idiopathic recurrent spontaneous abortion. Mol Hum Reprod 2001; 7(4): 373-8.

A survey on Relationship Between Progesterone Receptor Gene Polymorphisms and Recurrent Spontaneous Abortions: A Short Report

F. Naseri Arzanagh[3], S. Morovvati[4]

Received: 27/09/2015      Sent for Revision: 22/11/2015      Received Revised Manuscript: 21/02/2016     Accepted: 09/03/2016

Background and Objectives: Recurrent Spontaneous Abortions (RSA) is defined as the repeated occurrence of 2 or more miscarriages before 20th week of gestation. RSA is a multifactorial disorder and genetic defects are considered as one of the major risk factors for recurrent miscarriage. It seems the progesterone receptor gene polymorphisms to be one of the genetic factors involved in the occurrence of recurrent miscarriage. The aim of this study was  investigating the  relationship between the progesterone receptor gene polymorphisms and RSA.

Materials and Methods: In this cross-sectional study, a total of 50 women with at least two repeated abortions as patients group and 50 women without abortion history and with at least two successful pregnancy as control group were screened for two functional single nucleotide polymorphisms (SNP), G1031C and G1978T, in progesterone receptor gene using PCR-ARMS technique. Data was analyzed by chi-square and Fisher's exact tests.

Results: In SNP G1031C, the frequencies of GG, CC and GC alleles in the control group were 72%, 6% and 22%, respectively and in the patients were respectively 54%, 16% and 30% (P =0.008) in which the difference was statistically significant. In SNP G1978T, the frequencies of GG, TT and GT alleles in the controlgroup were 76%, 0% and 24%, respectively and in the patients were respectively 70%, 2% and 28% (P =0.510) in which the difference in two groups was not statistically significant.
Conclusion: The results of this study showed that the polymorphism G1031C is significantly higher in the patients with idiopathic recurrent pregnancy loss (RPL) than in the control subjects. However the association between the polymorphism G1978T and RSA is not significant. Therefore, the same study in a larger population may suggest the G1031C as a diagnostic marker for susceptibility to recurrent miscarriage.

Key words: Single Nucleotide Polymorphism (SNP), Polymorphism, Progesterone receptor gene, Recurrent spontaneous abortions (RSA)

Funding: There was no funding for this article. This article did not have any sponsor.

Conflict of interest: None declared.

Ethical approval: The Ethics Committee of the Baqiyatallah University of Medical Sciences approved the study.

How to cite this article: Naseri Arzanagh F, Morovvati S. A Survey on Relationship Between Progesterone Receptor Gene Polymorphisms and Recurrent Spontaneous Abortions: A Short Report. J RafsanjanUniv Med Sci 2016; 15(3): 287-92. [Farsi]

 

[1]- کارشناس ارشد سلولی مولکولی، واحد علوم دارویی، دانشگاه آزاد اسلامی، تهران، ایران

[2]- (نویسنده مسئول) دانشیار مرکز تحقیقات ژنتیک انسانی، دانشگاه علوم پزشکی بقیه‌الله(عج)، تهران، ایران

    تلفن: 82482529-021، دورنگار: 26413382-021، پست الکترونیکی: morovvati@hotmail.com

[3]- MSc in Cellular Molecular , Medicinal Sciences Unit of  Azad University, Tehran, Iran

[4]- Associate Prof., Dept. ofHuman Genetics Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran

(Corresponding Author) Tel: (021) 26413382, Fax: (021) 82482529, Email: morovvati@hotmail.com

نوع مطالعه: پژوهشي | موضوع مقاله: زنان
دریافت: ۱۳۹۳/۶/۲۲ | پذیرش: ۱۳۹۴/۱۲/۱۹ | انتشار: ۱۳۹۵/۴/۲۲

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb