جلد 14، شماره 5 - ( 4-1394 )                   جلد 14 شماره 5 صفحات 427-434 | برگشت به فهرست نسخه ها

XML English Abstract Print

Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Alizadeh S, Amini K. Identification of Virulence Gene Panton-Valentine Leukocidin (PVL) and Resistance to Methicillin (mecA) in Staphylococcus Aureus Isolated from Clinical Specimens: A Short Report. JRUMS. 2015; 14 (5) :427-434
URL: http://journal.rums.ac.ir/article-1-2485-fa.html
علیزاده سجاد، امینی کیومرث. شناسایی ژن‌های حدت پنتون ‌والنتین لوکوسیدین (PVL) و مقاومت به متی‌سیلین (mecA ) در استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی‌: یک گزارش کوتاه. مجله دانشگاه علوم پزشکی رفسنجان. 1394; 14 (5) :427-434

URL: http://journal.rums.ac.ir/article-1-2485-fa.html

دانش آموخته دانشگاه آزاد سیرجان
متن کامل [PDF 184 kb]   (809 دریافت)     |   چکیده (HTML)  (2729 مشاهده)
متن کامل:   (75 مشاهده)
گزارش کوتاه

مجله دانشگاه علوم پزشکی رفسنجان

دوره 14، مرداد 1394، 434-427

شناسایی ژن‌های حدت پنتون ‌والنتین لوکوسیدین (PVL) و مقاومت به متی‌سیلین (mecA ) در  استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی‌: یک گزارش کوتاه

سجاد علیزاده[1]، کیومرث امینی[2]

دریافت مقاله: 29/10/93    ارسال مقاله به نویسنده جهت اصلاح: 25/11/93  دریافت اصلاحیه از نویسنده: 20/12/93    پذیرش مقاله: 6/3/94



زمینه و هدف: استافیلوکوکوس‌ اورئوس یکی از مهمترین عوامل بیماریزای انسان در جهان می‌باشد. استافیلوکوکوس اورئوس مقاوم به متی‌سیلین با عفونت‌های بیمارستانی مرتبط می‌باشد. اخیراً ابتلا به عفونت‌های استافیلوکوکی مرتبط با جامعه شناخته شده‌اند. هدف مطالعه حاضر، جداسازی باکتری استافیلوکوکوس اورئوس و شناسایی ژن حدت پنتون والنتین لوکوسیدین و ژن مقاومت به متی‌سیلین در نمونه‌های بالینی با استفاده از تکنیک PCR بوده است.

مواد و روش‌ها: در این مطالعه آزمایشگاهی پس از جمع‌آوری نمونه‌ها،‌ آزمون‌های مختلف بیوشیمیایی و میکروبی انجام و سپس آزمون حساسیت آنتی‌بیوتیکی به روش دیسک دیفیوژن بر اساس دستورالعمل CLSI با آنتی‌بیوتیک‌هایی از گروه‌های مختلف انجام گردید. جهت شناسایی ژن‌های حدت و مقاومت از آزمون PCR چندگانه‌ای استفاده شد.

یافته‌ها: نتایج نشان داد فراوانی ژن مقاوم به متی‌سیلین (mecA) در نمونه‌های بالینی 50 % و ژن PVL  5/2% بود. در میان آنتی‌بیوتیک‌ها، مقاومت به آزیترومایسین، لینزولید، اوفلوکساسین و متی‌سلین به ترتیب 5/32 %، 35%، 5/27 % و 5/27% بیش از سایر آنتی‌بیوتیک‌های مورد آزمایش بود.

نتیجه‌گیری: به دلیل اهمیت استافیلوکوکوس اورئوس به عنوان مهمترین عامل بیماریزا در کشورهای در حال توسعه و با توجه به افزایش روزافزون مصرف و مقاومت نسبت به عوامل آنتی‌باکتریال خطر جدی سلامت جامعه را تهدید می‌کند. روش PCR چندگانه‌ای یک روش ساده، حساس، کم هزینه، نسبتاً سریع و بسیار اختصاصی است که توانایی شناسایی چندین ژن را نیز به طور همزمان دارد.

واژه‌های کلیدی: استافیلوکوکوس اورئوس، آنتی‌بیوگرام، ژن مقاوم به متی سیلین، ‍ لوکوسیدین پنتون والنتین، واکش زنجیره‌ای پلی مراز چندگانه‌ای


استافیلوکوکوس اورئوس یکی از مهمترین عوامل بیماری‌زا است که هر ساله تعدادی به این باکتری مبتلا می‌شوند ]1[.  استافیلوکوکوس اورئوس بر روی غشاهای مخاطی و پوست پستانداران، مواد غذایی مختلف و محیط اطراف یافت می‌شود و عامل ایجاد ذات‌الریه بعد از عفونت‌های ویروسی، التهاب وریدها، مننژیت، عفونت دستگاه ادراری؛ التهاب موضعی استخوان‌ها، اندوکاردیت، ضایعات سطحی پوست و غیره می‌باشد ]1[. مقاومت استافیلوکوکوس اورئوس نسبت به متی‌سیلین، ناشی از حضور ژن mecA است که رمز‌کننده یک پروتئین متصل‌شونده به پنی‌سیلین می‌باشد ]2[. توکسین ‌پنتون ‌والنتین لوکوسیدین (PVL) یک اگزوتوکسین همولیتیک است که باعث افزایش قدرت نفوذ‌پذیری غشاء سلولی و در نتیجه سبب لیز شدن لکوسیت‌ها و نکروز بافت می‌شود ]3[. عوامل بیماری‌زای لوکوسیدینی در استافیلوکوکوس‌اورئوس مقاوم به متی‌سیلین ‌بسیار پایدارند و به حرارت پاستوریزاسیون و بسیاری از آنزیم‌های پروتئولیتیک مقاوم بوده و می‌توانند در نمونه‌های غذایی برای مدت طولانی فعال بمانند. هدف از این تحقیق شناسایی سریع ژن‌های حدت و تعیین الگوی مقاومت آنتی‌بیوتیکی استافیلوکوکوس اورئوس مقاوم به متی‌سیلین جدا شده از نمونه های بالینی با روش PCR در جهت درمان مناسب و ارزیابی همه‌گیرشناسی و جلوگیری از به وجود آمدن سویه‌های مقاوم بود.


مواد و روش‌ها

در این مطالعه آزمایشگاهی تعداد 120 نمونه از بیماران مبتلا به عفونت‌های ادراری، ترشحات چرکی، آسپیراسیون تراشه و مایع مغزی نخاعی از مراکز درمانی شهر تهران در سال 92 جمع‌آوری گردید. این نمونه‌ها جهت کشت بر روی محیطهای بلاد آگار، مانیتول سالت آگار و کروم آگار استافیلوکوکوس اورئوس انتقال داده شده و در 37 درجه‌ سانتی‌گراد به مدت 24 ساعت در گرمخانه قرار داده شد. جهت تعیین هویت گونه‌های باکتری از آزمون‌های بیوشیمیایی استفاده شد که در نهایت 40 جدایه باکتری استافیلوکوکوس‌اورئوس از مجموع نمونه‌های جمع‌آوری شده شناسایی گردید. این مطالعه بر اساس آزمون‌های توصیفی انجام و این تعداد نمونه انتخاب گردید.

جهت انجام آزمون آنتی‌بیوگرام از روش دیسک دیفیوژن (Disk diffusion) به روش کربی بائر و بر طبق دستورالعمل CLSI (Clinical and Laboratory Standards Institute) استفاده گردید. تعدادی از کلونی باکتری را بوسیله آنس برداشته و در سرم فیزیولوژی استریل حل نموده تا برابر با کدورت استاندارد نیم مک فارلند گردد. سپس بر روی محیط مولر هینتون آگار کشت داده و دیسک‌های آنتی‌بیوتیک با فاصله استاندارد بر روی محیط کشت قرار داده و در دمای 37 درجه سانتی‌گراد انکوبه گردیده و بعد از 24 ساعت نتایج قرائت گردید ]4[. جهت انجام این مطالعه دیسکهای آنتی‌بیوتیک آزیترومایسین، کلیندامایسین، لینزولید، اوفلوکساسین، ونکومایسین، متی‌سیلین، (دالفوپریستین/کوینوپریستین) از شرکت HIMEDIA (Himedia Laboratories Pvt.Limited-INDIA) تهیه گردید. جهت بررسی کنترل کیفی آزمایشات از جدایه استاندارد استافیلوکوکوس اورئوس ATCC25923 به عنوان کنترل مثبت استفاده شد.

برای استخراج DNA از کیت باکتریهای گرم مثبت سیناژن (Cinna Pure DNA KIT-PR881614) استفاده گردید. برنامه آزمون Multiplex-PCR : مرحله واسرشت اولیه 95 درجه سانتی‌گراد به مدت 5 دقیقه، مرحله واسرشت 95 درجه سانتی‌گراد به مدت 40 ثانیه، مرحله اتصال 58 درجه سانتی‌گراد به مدت 1 دقیقه، مرحله بسط 72 درجه سانتی‌گراد به مدت 2 دقیقه (تعداد 40 سیکل)، مرحله بسط نهایی 72 درجه سانتیگراد به مدت 7 دقیقه می‌باشد. پرایمرهای مورد استفاده در این تحقیق شامل، پرایمر شناسایی باکتری استافیلوکوکوس اورئوس با طول باند bp ‌756­(AACTCTGTTATTAGGGAAGAACA)Staph756F (CCACCTTCCTCCGGTTTGTCACC )Staph750R ، پرایمر شناسایی ژن PVL با طول باند bp 433ATCATTAGGTAAAATGTCTGGACATGATCCA))Luk-PV-1، Luk-PV-2  (GCATCAAGTGTATTGGATAGCAAAAGC)، همچنین، پرایمر شناسایی ژن مقاومت به متی‌سیلین با طول باند bp310­GTAGAAATGACTGAACGTCCGATAA))mecA1،  mecA2(CCAATTCCACATTGT TTCGGTCTAA)  می‌باشد ]5[. مخلوط‌های استفاده شده جهت انجام واکنش به این شرح می‌باشد: آب مقطر 7/16 میکرولیتر، 1X. PCR buffer به میزان 25/1 میکرولیتر،MgCl2  به میزان 25/1 میکرولیتر، (dNTP mix (5Mm به میزان 2/0 میکرولیتر، پرایمرهای مورد استفاده هرکدام 5/1 میکرولیتر، آنزیمTag polymerase  به میزان 1/0 میکرولیتر، نمونه DNA 5/2 میکرولیتر در حجم نهایی 25 میکرولیتر تهیه گردید. آزمون Multiplex-PCR در دستگاه BIORAD انجام شد. جهت بررسی محصول Multiplex-PCR نمونه‌ها بر روی ژل آگارز 1% انتقال داده شده و بعد از رنگ‌آمیزی در دستگاه ژل داک BIORAD مورد بررسی قرارگرفت.‌ داده‌های آماری با نرم‌افزار SPSS نسخه 13 و با استفاده از آزمون‌های آماری توصیفی مورد تجزیه و تحلیل قرار گرفت.


این تحقیق بر روی40 ایزوله استافیلوکوکوس‌اورئوس جداسازی شده انجام گرفت. میزان حساسیت سویه­های مختلف به آنتی‌بیوتیک‌های مورد استفاده در جدول 1 ذکر شده است.

بیشترین حساسیت به آنتی‌بیوتیک ونکومایسین 95% و بیشترین مقاومت به آنتی‌بیوتیک لینزولید 35% گزارش شده است. میانگین سنی مردان 55/38 سال و میانگین سنی زنان 38/39 سال بودکه در هر دو جنس میانگین سن نزدیک به هم گزارش شده است. توزیع فراوانی باکتری استافیلوکوکوس اورئوس جداسازی شده در نمونه‌های بیماران بر حسب جنس در مردان 67% و در زنان 33% بوده است، که بیشترین فراوانی باکتری در مردان مشاهده شد. میزان توزیع ژن 16S rRNA جهت شناسایی تأییدی باکتری استافیلوکوکوس اورئوس در 40 نمونه تایید شده با آزمون‌های بیوشیمیایی به طور (100%) شناسایی شد. فراوانی سایر ژن‌ها شامل ژن   mec Aو Luks/F-PV به ترتیب 50% و 5/2% تأیید قطعی گردیدند.

                                                                جدول 1- میزان حساسیت سویه‌های جداسازی شده به آنتی‌بیوتیک‌های مختلف با روش دیسک دیفیوژن

میزان مقاومت (%)

حساسیت متوسط(%)

میزان حساسیت (%)

نوع آنتی‌بیوتیک

































همچنین، توزیع فراوانی هر یک از ژن‌های مورد استفاده بر حسب جنس نیز تعیین گردید که ژن 16S rRNA در هر دو جنس برابر با 50% و ژن mec A در مردان 35% و در زنان 15% گزارش شده و ژن Luks/F-PV فقط در مردان به میزان 5/2% شناسایی گردید. فراوانی ژن‌های mecA و Luk-PV در مردان بیشتر از زنان گزارش شده است. نتایج حاصل از شناسایی مولکولی ژن‌ها و محصول PCR در شکل 1 ذکر شده است.

Description: sajad1

شکل 1- الکتروفورز محصول PCR بر روی ژل آگارز

نتایج Multiplex PCR :از سمت چپ  به ترتیب Ladder 100 bp- سویه استاندارد کنترل مثبت - کنترل منفی -  نمونه 1 تا 7 همگی دارای ژن16S rRNA gene   (bp 756) می‌باشد.

نمونه 6 دارای ژنLukS/F-PV gene (  bp433 ) می‌باشد.

نمونه‌های( 5-2-1) دارای ژن mecA gene (bp310) می‌باشد.


مقاومت به آنتی‌بیوتیک یکی از مشکلات عمده بوده و استفاده گسترده از آنتی‌بیوتیک‌ها نقش عمده‌ای در ظهور باکتری‌های مقاوم بازی می‌کند. استافیلوکوکوس‌اورئوس که به عنوان دومین پاتوژن بیمارستانی محسوب می‌شود، بخشی از فلورطبیعی پوست و مجاری بینی می‌باشد. این ارگانیسم به طیف وسیعی از آنتی‌بیوتیک‌ها مقاوم می‌باشد. در مطالعه‌ای که توسطDarabi  و همکاران با عنوان ویژگی‌های مولکولی استافیلوکوکوس اورئوس جدا شده از بیماران و کارکنان بیمارستانی ارتش انجام شد، گزارش کردند 90% سویه‌ها مقاوم به متی‌سیلین و 25% سویه‌ها نسبت به کلیندامایسین مقاوم هستند ]6[. این نتایج با نتایج بدست آمده در این تحقیق مطابقت کمتری داشت، زیرا در مطالعه کنونی، افراد مقاوم به آنتی‌بیوتیک متی‌سلین حدود 5/27% و مقاومت به کلیندامایسین حدود 5/17% مشاهده شد. در مطالعه حاضر بیشترین مقاومت آنتی‌بیوتیکی سویه‌ها نسبت به آنتی‌بیوتیک لینزولید به میزان 35% و کمترین مقاومت آنتی‌بیوتیکی سویه‌ها به آنتی‌بیوتیک ونکومایسین و تیکوپلانین (بیشترین حساسیت آنتی‌بیوتیکی) گزارش شد. Najar Peerayeh و همکاران تحقیقی با عنوان شناسایی استافیلوکوکوس اورئوس مقاوم به متی‌سیلین از طریق انتشار دیسک و PCR و بررسی الگوی مقاومتی آن انجام دادند و بر این باورند که استافیلوکوکوس اورئوس از جمله عوامل مهم ایجاد عفونت‌های شدید بوده و سویه‌های مقاوم به متی‌سیلین این باکتری بیشترین عامل مرگ و میر در بیمارستان‌ها می‌باشند، لذا شناسایی و درمان سریع سویه‌های مقاوم به متی‌سیلین دارای اهمیت می‌باشد ]7[. بنابراین طی تحقیق حاضر نیز از مجموع نمونه‌ها بیشترین باکتری جداسازی شده استافیلوکوکوس اورئوس تشخیص داده شد که مطابق با تحقیق Najar Peerayeh و همکاران بوده و با انجام آزمون آنتی‌بیوگرام مقاومت به متی‌سیلین این جدایه‌ها با روش انتشار دیسک و PCR تعیین گردید، درصد مقاومت این باکتری‌ها نسبت به آنتی‌بیوتیک‌های رایج مورد بررسی قرار گرفت. نتایج به دست آمده از این تحقیق نشان داد با توجه به الگوی به دست آمده تنها یک سویه نسبت به ونکومایسین از خود مقاومت نشان داد می توان گفت که 95% سویه‌ها به ونکومایسین حساس می باشند و این آنتی‌بیوتیک هنوز کارایی لازم برای درمان عفونت‌های حاصل از سویه‌هایMRSA  را دارا می‌باشد ولی 100% نبودن کارایی این آنتی‌بیوتیک یک علامت هشدار برای یافتن آنتی‌بیوتیک‌های جدید و کارآمدتر می‌باشد. میزان بالای جداسازی باکتری  استافیلوکوکوس اورئوس در بین مردان موید این مطلب است که مردان با توجه به شرایط شغلی و تماس بیشتر با منابع عفونت، نقش بسزایی در انتقال عفونت ایفا می‌کنند. در اسپانیا در سال 2002 میزان عفونت‌های ناشی از MRSA 5/24% و در ایرلند، ایتالیا و فرانسه به ترتیب 4/41%، 1/40% و 1/33% بوده است ]8[. در مطالعه Razin و همکاران با روش دیسک دیفیوژن از 143 مورد استافیلوکوکوس اورئوس جداشده از نمونه‌های بیماران 113 نمونه (79%) به عنوان استافیلوکوکوس اورئوس مقاوم به متی‌سیلین گزارش شد ]9[. در صورتی که در مطالعه ما تعداد جدایه‌های مقاوم به متی‌سیلین با روش دیسک دیفیوژن 5/27% و با روش PCR در هر دو جنس از بین تعداد 40 نمونه 50% گزارش شده است.Gunawardena و همکاران در مطالعه‌ای با عنوان تشخیص ملکولی مقاومت متی‌سیلین و واگیری آن در استافیلوکوکوس اورئوس بر این باورند که استافیلوکوکوس اورئوس مقاوم به متی‌سیلین (MRSA) یکی از مهمترین عوامل بیماریزای بیمارستانی در سری‌لانکا محسوب می‌شود. بنابر موارد کشت جدایه‌های MRSA در وهله اول نیاز به تشخیص سریع و درمان‌های ضدمیکروبی مناسب دارد. ژن پنتون والنتین لوکوسیدین (PVL) یک فاکتور واگیرداری است که همراه با عفونت MRSA است که کشف آن زمان زیادی را به خود اختصاص می‌دهد و بستگی به محیط کشت آن دارد. نتایج پژوهش حاکی از این بود که حضور ژن های PVL  در 11 سویه شامل هر دو گروه MRSA، MSSA شناسایی گردید. 16 نمونه MecA مثبت و 14 تای آن ژن‌ها PVL مثبت بودند ]2[. هدف پژوهش ما نیز شناسایی این دو ژن MecA و PVL بوده است که از بین مجموع نمونه‌ها 50% حاوی ژن MecA بوده و 5/2% نمونه‌ها در مردان واجد ژن PVL بوده و در زنان این ژن شناسایی نگردید و با مطالعه Gunawardena و همکاران همخوانی نداشته که علت آن می‌تواند مخازن جداسازی عفونت و محل جغرافیایی باشد. با توجه به مطالعاتی که صورت گرفته درصد فراوانی ژن توکسین پنتون والنتین لوکوسیدین (PVL) در سویه‌های مقاوم به متی‌سیلین بیشتر است ]2[. بنابراین، در این تحقیق با توجه به نتایج حاصل از آزمایش دیسک دیفیوژن و مقایسه آن با الگوی استاندارد، بیشتر ایزوله‌های جدا شده و مورد بررسی نسبت به متی‌سیلین حساس هستند و نشان دهنده عدم بروز ژن (PVL) در سویه‌های مورد بررسی می‌باشد که تأییدکننده این مطلب است که برای بروز ژن PVL و ایجاد مقاومت، حضور ژن mec A ضروری است ]10[. بنابراین، به نظر می‌رسدکه تحقیق حاضر در مقایسه با سویه‌های جداشده از سایر نقاط کشور، با امکان بررسی وجود و عدم وجود ژن PVL، می‌تواند فاکتور مناسبی برای بررسی پراکندگی جغرافیایی این سویه‌ها باشد. همچنین در مطالعه ما بیشترین فراوانی ژن‌های مقاومت به متی‌سیلین بر حسب جنس در مردان بیشتر از زنان شناسایی گردید که می‌تواند به دلایل شغلی و تماس بیشتر با منبع عفونت باشد ولی موضوع مشترک در بین تمام این تحقیقات، گستردگی زیاد سویه‌های مقاوم به متی‌سیلین درجهان است که نشان دهنده خطر بالقوه همه‌گیری عفونت‌های استافیلوکوکوس اورئوس مقاوم به متی‌سیلین در دنیا می‌باشد. بنابراین، تشخیص سریع و به موقع جدایه‌های مقاوم به منظور انتخاب گزینه‌های درمانی مناسب و جلوگیری از گسترش مقاومت،  امری ضروری به نظر می‌رسد. با استفاده از روشMultiplex PCR  می‌توان در کوتاه ترین مدت زمان با ویژگی و حساسیت بالا به حضور ژن‌های بیماریزا پی برد و با درمان مناسب و به موقع از ایجاد سویه‌های مقاوم و انتقال این ژن‌ها در جمعیت‌های انسانی جلوگیری به عمل آورد. جهت کاهش مقاومت آنتی‌بیوتیکی باید دو فاکتور عمده یعنی استفاده زیاد از آنتی‌بیوتیک‌ها و سهولت گسترش ژن مقاومت را در نظر داشت. اقدامات کنترل عفونت و رعایت نکات بهداشتی در حذف یا کاهش این نوع سویه‌ها بویژه در بیمارستان‌ها باید بسیار جدی گرفته شود. همچنین، ضمن استاندارد شدن روش آنتی‌بیوگرام باید به نتایج تست حساسیت آنتی‌میکروبی عفونت‌ها جهت کاربرد صحیح آنتی‌بیوتیک مؤثر، توجه ویژه‌ای صورت گیرد.

تشکر و قدردانی

از کارکنان آزمایشگاه پژوهشی میکروبیولوژی پاسارگاد مهندس ابوالفضل مقدم، مهندس رامین خاکی جوان و آقای دکتر علیرضا مختاری که در انجام مراحل عملی این تحقیق همکاری نمودند تشکر و قدردانی می‌گردد.


[1] Adwan G, Abu-Shanab B, Adwan K. Enterotoxigenic Staphylococcus aureus in raw milk in the North of Palestine. Turk J Biol 2005; 29: 229-32.

[2] Gunawardena ND, Thevanesam V, Kanakaratne N, Abeysekera D, Ekanayake A, Perera N. Molecular identification of methicillin resistance and virulence marker in Staphylococcus aureus. Sri Lankan J Infect Dis 2012; 2(2): 18-29.

[3] Mola Abaszadeh Hamed MH, Mirzaee Hamid, Determines Panton-Valentine leukocidin (PVL) gene in Staphylococcus aureus strains isolated from patients Imam Reza and Tabriz martyrs  Hospital by Real-Time PCR. Sixth Congress of Clinical Microbiology and First International Congress of Clinical Microbiology; 2012: Mashhad Med J. [Farsi]

[4] Cockerill FR, Performance standards for antimicrobial disk susceptibility testing. Approved Standard Eleventh Edition M02-A11. National Committee for Clinical Laboratory Standards (CLSI); 2012; 32(1).

[5] McClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphyl ococci. J Clin Microbiol 2006; 44(3): 1141-4.

[6] Darabi Nahid HH, Shahbabian Karen. Molecular Epidemiology of Staphylococcus aureus Isolated from patients and personnel in Army hospital. Army Med J 2010; 8(3): 193-9. [Farsi]

[7] Najar Peerayeh S, Azimian A, Mostafaee M, Siadat SD. Identification of methicillin-resistant Staphylococcus aureus by disk diffusion method, determination of MIC and PCR for mecA gene. Modares Med J 2009; 12(3): 61-9. [Farsi]

[8] Oteo J, Baquero F, Vindel A, Campos J. Antibiotic resistance in 3113 blood isolates of Staphylococcus aureus in 40 Spanish hospitals participating in the European Antimicrobial Resistance Surveillance System (2000–2002). J Antimicrob Chemother 2004; 53(6): 1033-8.

[9] Razin bahram SM, Nabavi M, Thaghavi N, Haghighi M, Forumand M. Determine the prevalence of methicillin-resistant Staphylococcus aureus infection Imam Hussein hospital  in the years 1386-87. Pajohandeh Med J 1388; 5(14): 263-7. [Farsi]

[10] Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis 2003; 9(8): 978-84.


Identification of Virulence Gene Panton-Valentine Leukocidin (PVL) and Resistance to Methicillin (mecA) in Staphylococcus Aureus Isolated from Clinical Specimens: A Short Report

S. Alizadeh[3], K. Amini[4]

Received: 19/01/2015      Sent for Revision: 14/02/2015      Received Revised Manuscript: 11/03/2015     Accepted: 27/05/2015

Background and Objective: Staphylococcus aureus is a major pathogen of human in the world. Methicillin-resistant Staphylococcus aureus is associated with nosocomial infections. Recently, staphylococcal infections have been associated with the community. The purpose of this study was to isolate and identify Staphylococcus aureus virulence Panton-Valentine leukocidin (PVL) and  methicillin resistance genes in clinical samples using PCR techniques.

Materials and Methods:In this experimental study after collecting samples, it was performed biochemical and microbial tests and then antibiotic susceptibility testing by disk diffusion method according to CLSI guidelines with antibiotics of different groups. To identify the virulence and resistance genes multiplex PCR test was used.

Results: The findings showed that the prevalence of methicillin-resistant gene (mecA) in clinical samples are 50% and PVL 2.5%, respectively. Among the antibiotics, resistance to azithromycin, linezolid, ofloxacin and methicillin  were 32.5%, 35%, 27.5% and 27.5%, respectively.

Conclusion :There is a serious threat for public health because of the importance of Staphylococcus aureus as a major pathogen in developing countries and due to the increasing use of antibacterial agents. Multiplex PCR is a simple, sensitive, inexpensive, relatively quick, and very unique test to identify multiple of genes, simultaneously.

Keywords: Staphylococcus aureus, mec A, Panton-Valentine Leukocidin, Multiplex PCR

Funding: This research was funded by Sirjan Science and Research Branch, Islamic Azad University of Sirjan.

Conflict of interest: None declared.

Ethical approval: None declared.

How to cite this article: Alizadeh S, Amini K. Identification of Virulence Gene  Panton-Valentine Leukocidin (PVL) and Resistance to Methicillin (mecA) in Staphylococcus Aureus Isolated from Clinical Specimens: A Short Report. J Rafsanjan Univ Med Sci 2015; 14(5): 427-34. [Farsi]


[1]- دانش‌آموخته کارشناسی ارشد گروه میکروبیولوژی دانشگاه آزاد اسلامی، واحد سیرجان، سیرجان، ایران

[2]- (نویسنده مسئول) استادیار گروه میکروبیولوژی، دانشکده علوم پایه، دانشگاه آزاد اسلامی واحد ساوه، ساوه، ایران

    تلفن: 42241511-086، دورنگار: 42241511-086، پست الکترونیکی: kamini@iau-saveh.ac.ir

[3]-MSc in Dept. of Microbiology, Sirjan Branch, Islamic Azad University, Sirjan, Iran

[4]- Assistant Prof., Dept. of Microbiology, Saveh Branch, Islamic Azad University, Saveh, Iran

(Corresponding Author) Tel: (086) 42241511, Fax: (086) 42241511, E-mail: kamini@iau-saveh.ac.ir

نوع مطالعه: پژوهشي | موضوع مقاله: ميكروبيولوژي
دریافت: ۱۳۹۳/۱۰/۲۸ | پذیرش: ۱۳۹۴/۳/۶ | انتشار: ۱۳۹۴/۴/۲۴

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb