جلد 14، شماره 4 - ( 3-1394 )                   جلد 14 شماره 4 صفحات 269-282 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Tabatabaei Qomi R, Sheykhhasan M, Kalhor N, Ghiasi M. Introduction of Pellet Culture System of Human Adipose- Derived Mesenchymal Stem Cells as an In Vitro Model for Cartilage Engineering Approaches . JRUMS. 2015; 14 (4) :269-282
URL: http://journal.rums.ac.ir/article-1-2547-fa.html
طباطبائی قمی رضا، شیخ حسن محسن، کلهر ناصر، قیاثی مهدیه. معرفی سیستم کشت پلت سلول‌های بنیادی مزانشیمی مشتق از بافت چربی انسان به عنوان یک مدل کشت آزمایشگاهی به منظور اهداف مهندسی بافت غضروف. مجله دانشگاه علوم پزشکی رفسنجان. 1394; 14 (4) :269-282

URL: http://journal.rums.ac.ir/article-1-2547-fa.html


کارشناسی ارشد جهاد دانشگاهی استان قم، قم، اﻳﺮان
متن کامل [PDF 412 kb]   (1576 دریافت)     |   چکیده (HTML)  (4050 مشاهده)
متن کامل:   (93 مشاهده)
مقاله پژوهشی

مجله دانشگاه علوم پزشکی رفسنجان

دوره 14، تیر 1394، 282-269

معرفی سیستم کشت پلت سلول‌های بنیادی مزانشیمی مشتق از بافت چربی انسان به عنوان یک مدل کشت آزمایشگاهی به منظور اهداف مهندسی بافت غضروف

رضا طباطبائی قمی[1]، محسن شیخ حسن[2]، ناصر کلهر[3]، مهدیه غیاثی[4]

دریافت مقاله: 9/12/93      ارسال مقاله به نویسنده جهت اصلاح: 22/1/94    دریافت اصلاحیه از نویسنده: 19/2/94      پذیرش مقاله: 20/2/94

AWT IMAGEچکیده

زمینه و هدف: بیماری‌ها و آسیب‌های مختلف می‌توانند منجر به از بین رفتن بافت غضروفی شوند. ایجاد روش مهندسی بافت غضروف بر پایه سلول‌های بنیادی، فرصت امیدوارکننده‌ای را به منظور ترمیم سلول‌های آسیب دیده فراهم ساخته است. به تازگی، سلول‌های بنیادی مزانشیمی مشتق از چربی به دلیل خصوصیات منحصر به فردی همچون تمایز به رده‌های مختلف سلولی توجه زیادی را به خود معطوف ساخته است. هدف از انجام این مطالعه، معرفی سیستم کشت پلت سلول‌های بنیادی مزانشیمی مشتق از چربی انسان به عنوان یک مدل کشت آزمایشگاهی به منظور اهداف مهندسی بافت غضروف می‌باشد.

مواد و روش‌ها: این مطالعه به صورت آزمایشگاهی در سال 1391 در آزمایشگاه سلول‌های بنیادی جهاد دانشگاهی قم انجام شد. در این مطالعه، ابتدا سلول‌های بنیادی مزانشیمی از بافت چربی انسان جداسازی شده و پس از تکثیر در محیط آزمایشگاهی توسط انجام سانتریفوژ به شکل سیستم پلت در محیط تمایزی کندروژنیک حاوی محیط DMEM کشت گردیده و توانایی بقای سلولی و بیان ژن‌های ویژه غضروف به ترتیب به وسیله روش‌های MTT  و Real-time PCR مورد ارزیابی قرار گرفت. در این مطالعه، تجزیه و تحلیل داده‌ها توسط آزمون t مستقل صورت پذیرفت.

یافته‌ها: نتایج حاصل از این مطالعه با استفاده از ارزیابی MTT و Real-time PCR به ترتیب توانایی بقا و تکثیر سلولی و بیان ژن‌های مخصوص غضروف را در سلول‌های تمایز یافته به بافت چربی با استفاده از سیستم کشت پلت مشخص نمود.

نتیجه‌گیری: طبق نتایج حاصل از این مطالعه، روش کشت پلت می‌تواند به عنوان یک راهکار مناسب جهت تمایز سلول‌های بنیادی مزانشیمی مشتق از چربی به رده غضروفی مورد استفاده قرار گیرد.

واژه‌های کلیدی: سلول‌های بنیادی مزانشیمی مشتق از بافت چربی انسان، سیستم کشت پلت، تمایز به رده غضروفی

مقدمه

نقص غضروف به علت ضربه، برداشتن تومور یا سایش مرتبط با سن منجر به درد مداوم و محدودیت‌های عملکردی مفاصل و مشکلات پزشکی و اجتماعی در افراد بیمار و سالخورده خواهد شد. این اعتقاد وجود دارد که حتی ضایعات کوچک می‌تواند به شدت بر روی ساختار و عملکرد غضروف مفصلی تأثیر بگذارد و امکان ایجاد استئوآرتریت را فراهم سازد [1]. این امر به دلیل عدم وجود عروق خونی در بافت غضروف و در نتیجه امکان بازسازی ضعیف صدمات وارده به این بافت می‌باشد.

کندروسیت‌های اتولوگ به عنوان یک منبع سلول‌های اولیه جهت بازسازی غضروف‌های معیوب و آسیب دیده در نظر گرفته می‌شود و به صورت بالینی مورد استفاده قرار می‌گیرد [3-1]. با این حال، عوارض ایجاد شده در محل برداشت نمونه و از دست دادن فنوتیپ آن، خود از جمله مشکلات استفاده از این سلول‌ها می‌باشد. در نتیجه نیاز به استفاده از روش‌هایی است که در درمان نواقص غضروفی دارای پتانسیل بالایی بوده و به بازسازی ضایعات غضروفی کمک کند [2-1]. از مهمترین این روش‌ها، مهندسی بافت است که فرآیندی است که به خلق بافت‌های سه بعدی دارای عملکرد با استفاده از ترکیب داربست و سلول‌های مناسب و عواملی که رشد سلولی، سازماندهی و تمایز آن‌ها را تسهیل می‌نماید می‌پردازد [4].

به تازگی، سلول‌های بنیادی مزانشیمی‌مشتق از چربی توجه زیادی را در بازسازی بافت نرم به خود معطوف ساخته است. این سلول‌ها توانایی تمایز به غضروف، استخوان، عضله و چربی را در حضور فاکتورهای تمایزی و شرایط کشت مناسب دارا هستند. سلول‌های بنیادی مزانشیمی مشتق از چربی چندتوانی خود را در شرایط آزمایشگاهی در طول چندین پاساژ حفظ نموده و توانایی غضروف‌سازی را با گسترش  و تکثیر سلولی افزایش داده و حفظ می‌نمایند. این سلول‌ها در مقایسه با سلول‌های مشابه مشتق از بافت‌های دیگر از جمله مغز استخوان، دارای ویژگی‌ها و مزایای فراوانی هستند که از جمله آنها می‌توان به دسترسی آسان این سلول‌ها از بیمار در مقادیر نسبتاً فراوان با استفاده از روش لیپوساکشن اشاره نمود [1]. آنها در حال حاضر به عنوان وسیله درمان نقص بافت با سلول‌های بنیادی خود فرد به حساب می‌آیند.

مهندسی بافت غضروفی بر پایه سلول‌های بنیادی مزانشیمی مشتق از چربی، راهکار مستحکمی را جهت گسترش بافت‌های غضروفی سه بعدی توسط ترکیب با مواد زیستی مناسب و فاکتورهای رشد مطلوب ایجاد نموده است [4].

از فاکتور TGF-β جهت القای فرآیند تمایز سلول‌های بنیادی مزانشیمی مشتق از چربی به غضروف به طور گسترده‌ای استفاده شده است [1]. تمایز سه بعدی سلول‌ها معمولاً بر روی داربست‌های سه بعدی و در محیط تمایزی ویژه‌ای صورت می‌پذیرد. علاوه بر فاکتورهای رشد خارجی، داربست‌های مختلف به عنوان یک ماتریکس حفاظتی سه بعدی برای رشد مناسب سلول‌ها و بافت‌ها مورد استفاده قرار گیرد. سیستم‌های کشت سه بعدی به دلیل قابلیت آنها در حفظ و نگهداری فنوتیپهای طبیعی سلول‌ها برای مطالعات بر روی قابلیت تمایز سلول‌های بنیادی مشتق از چربی به رده غضروفی ارزشمند هستند [4].

اخیرا، روش کشت پلت برای تمایز به غضروف سلول‌های بنیادی مزانشیمی مشتق از چربی استفاده شده است. روش کشت پلت یکی از ساده‌ترین سیستم‌های کشت سه بعدی است که جهت غضروف‌سازی سلول‌های بنیادی مختلف به کار رفته است [5]. در این مطالعه، سیستم کشت پلت به عنوان روش مناسبی جهت تکثیر و تمایز سلول‌های بنیادی مزانشیمی مشتق از چربی بررسی گردیده است.

با توجه به مطالعات مشابه انجام شده، وجه تمایز تحقیق حاضر استفاده از فاکتور رشد TGF-β3 به عنوان مهمترین فاکتور القای تمایز و بررسی قدرت بقای سلول‌های تمایز داده شده به غضروف و بیان ژن‌های ویژه غضروفی به ترتیب با استفاده از روش‌های MTT و Real-time PCR می‌باشد.

مواد و روش‌ها

در این مطالعه آزمایشگاهی (in vitro)، برای جداسازی سلول‌های بنیادی مزانشیمی، مقدار 5 گرم بافت چربی شکمی از 3 بیمار که تحت عمل نفرکتومی قرار داشتند به دست آمد. از تمامی بیماران (میانگین سنی 48 سال) رضایت‌نامه کتبی اخذ گردید. نمونه چربی اخذ شده در محلول فسفات بافر سالین (Gibco, Life Technologies, USA) حاوی آنتی‌بیوتیک پنی‌سیلین-استرپتومایسین (Gibco, Life Technologies, USA) 1% تحت شرایط استریل از بیمارستان به آزمایشگاه منتقل و پس از چندین بار شستشو با فسفات بافر سالین و سرم فیزیولوژی به قطعات کوچک تبدیل شد. سپس سلول‌های بنیادی مزانشیمی به وسیله هضم با آنزیم کلاژناز I 2/0% از بافت چربی استخراج گردید. به این صورت که ابتدا به ازای هر یک گرم چربی 5/1 میلی‌گرم آنزیم کلاژناز I به آن اضافه و به مدت 45 تا 60 دقیقه در دمای 37 درجه سانتی‌گراد انکوبه شد. سپس به مدت 10 دقیقه با سرعت 1800 دور در دقیقه تحت سانتریفیوژ قرار گرفته و در نهایت رسوب سلولی در محیط کشت  Dulbecco's Modified Eagle's Medium (DMEM) (Sigma-Aldrich, USA) حاوی آنتی‌بیوتیک پنی‌سیلین/استرپتومایسین 1% و سرم جنین گوساله (Gibco, Life Technologies, USA) 10% به فلاسک مخصوص کشت سلول منتقل و در انکوباتور 37 درجه سانتی‌گراد حاوی دی‌اکسید کربن 5% و رطوبت 95% قرار داده شدند. پس از گذشت 24 ساعت، سلول‌های معلق با تعویض محیط از فلاسک حذف شدند. محیط کشت سلول‌ها هر 3 روز یک بار تعویض گردید. سلول‌ها پس از تریپسینه شدن به مرحله پاساژ سوم انتقال یافتند و جهت استفاده آماده شدند [4].

در این مطالعه، به منظور تمایز کندروژنیک از سیستم کشت سه بعدی استفاده شد. پلت‌ها بوسیله سانتریفیوژ تعداد 106×1 سلول بنیادی مشتق از بافت چربی با دور 1400 دور در دقیقه به مدت 10 دقیقه در تیوپ‌های 15 میلی‌لیتری تشکیل شدند (شکل 1). محیط کندوژنیک شامل DMEM-High Glucose به همراه انسولین-ترانسفرین-سلنیوم (Sigma-Aldrich, USA) 1%، دگزامتازون (Sigma-Aldrich, USA) 100 نانومولار، سرم آلبومین گاوی (Sigma-Aldrich, USA) 1%، آسکوربات 2-فسفات (Sigma-Aldrich, USA) 50 میکروگرم بر لیتر، لینولئیک اسید (Sigma-Aldrich, USA) 5 میکروگرم بر لیتر، فاکتور رشد TGF-β3 (Sigma-Aldrich, USA) و پنی سیلین-استرپتومایسین 1% بوده و سپس در داخل انکوباتور با دمای 37 درجه سانتی‌گراد و دی اکسیدکربن 5% به مدت 14 روز نگهداری و هر 3-2 روز محیط کشت تعویض شدند.

AWT IMAGE

شکل 1- تصویر  شماتیکی از مراحل مختلف سیستم کشت پلت

بررسی قابلیت بقای سلول پس از گذشت 14 روز از کشت سلول‌ها بر روی داربست‌ها و در حضور محیط تمایز به غضروف انجام پذیرفت. نیم میلی‌لیتر محیط کشت DMEM و 50 میکرولیتر محلول MTT (3(4 و 5-دی متیل) تیازول-2-یل-2و5-دی متیل تترازولیوم بروماید, 5 میلی‌گرم/میلی‌لیتر)  (Sigma-Aldrich, USA) به داربست‌ها اضافه شد. پس از 4 ساعت انکوباسیون، نیم میلی‌لیتر دی متیل سولفوکسید (DMSO) به محلول حاصل اضافه شد. پس از گذشت 20 دقیقه در نهایت میزان جذب نوری سلول/داربست در طول موج 570 نانومتر توسط دستگاه میکروپلیت ریدر اندازه گیری شد (شکل 2) [6].

ابتدا تمامی نمونه‌های RNA پس از گذشت 14 روز از تمایز کندروژنیک از هر کدام از داربست‌ها به طور جداگانه تهیه شد. داربست‌ها در داخل نیتروژن مایع تخریب شده و سپس RNA با استفاده از کیتAccuZolTM (bioNEER, Korea)  و طبق دستورالعمل مربوطه استخراج گردید.

AWT IMAGE

شکل 2– تصویر شماتیکی از انجام تست MTT

نسخه‌برداری معکوس RNA به cDNA با استفاده از کیت AccPower®RT Premix (bioNEER, Korea) و طبق دستورالعمل مربوطه انجام پذیرفت.Real-time PCR  با استفاده از SYBRGreen PCR Master Mix (Amplicon, UK) و Rotor-GeneTM 6000 Series software version 1/7/65 (Corbett Life Science, UK) انجام پذیرفت.

واکنش PCR برای ژن‌های SOX9 و اگریکان طبق برنامه زیر صورت پذیرفت:

در ابتدا مخلوط واکنش به مدت 15 دقیقه و به دنبال آن به مدت 15 ثانیه در دمای 95 درجه گرمادهی شد. سپس در دمای 58 درجه به مدت 40 ثانیه قرار گرفت.
همچنین، برنامه حرارتی استفاده شده در واکنش PCR ژن‌های کلاژن I وII شامل دمای 95 درجه به مدت 15 دقیقه جهت واسرشت شدن اولیه، دمای 95 درجه به مدت 15 ثانیه جهت واسرشت شدن و دمای 58 درجه به مدت 35 ثانیه جهت اتصال پرایمرها بود. واکنش از مرحله دوم به بعد، برای 40 سیکل تکرار شد.

پرایمرها با استفاده از برنامه پرایمر 3 برای هر کدام از ژن‌ها طراحی شد که بر طبق توالی ذکر شده در جدول 1 می‌باشد. ژن مورد نظر بر اساس ژن رفرنس بتا-اکتین نرمال‌سازی شد. سطح بیان هر کدام از ژن‌های هدف با استفاده از 2-∆∆Ct محاسبه گردید [6].

جدول 1- توالی پرایمر ژن های مورد استفاده در آنالیز Real-time PCR

نام پرایمر

توالی مستقیم ژن کلاژن نوع  I

توالی معکوس ژن کلاژن نوع  I

توالی مستقیم  ژن اگریکان

توالی معکوس ژن اگریکان

توالی مستقیم ژن  Sox9

توالی معکوس ژن  Sox9

TTGTACAGACATGACAAGAGGC

CTCTACCTGGGTACTACCCA

CAGAGTGAAATCCACCAAGT

TGTCCGTGGACAAACAGGTA

TACGACTACACGCACCACCA

TTAGGATCATCTGCGCCATC

توالی مستقیم ژن کلاژن نوع   II توالی معکوس ژن کلاژن نوع   II

ACACAGCGCCTTGAGAAGAG

TTCTACGGTCTCCCCAGAGA

در این آزمایش با استفاده از مقایسه میانگین آزمون t مستقل، معنی‌دار بودن تفاوت رشد و تمایزی سلول‌های بنیادی کشت شده بر روی دو داربست مشخص گردید. آنالیز  MTTبرای هر نمونه 4 بار تکرار شد. آنالیز آماری با استفاده از نرم‌افزار SPSS (نسخه 17) انجام پذیرفت و سطح معنی داری در آزمون‌ها 05/0p< در نظر گرفته شد.

نتایج

طی جداسازی و تکثیر سلولی، سلول‌های بنیادی مزانشیمی مشتق از چربی با ظاهری شبیه به فیبروبلاست یا دوکی شکل با هسته‌های مشخص رشد کردند که توسط میکروسکوپ فاز متضاد (BHS, OLYMPUS, USA) مشاهده گردید (شکل 3).

AWT IMAGE

شکل 3- سلول‌های بنیادی مزانشیمی مشتق از بافت چربی (بزرگنمایی  X40)

در پاساژ سوم، سلول‌های یکنواختی با رشد و افزایش در تعداد آنها حاصل شد. در این مرحله، از تعداد 106×5 سلول/ میلی‌لیتر جهت ایجاد سیستم کشت پلت استفاده گردید. نتایج حاصل از این مطالعه نشان داد از لحاظ آزمون t مستقل با احتمال 05/0p< بقای سلول‌های تمایز یافته به غضروف (شکل 4)

AWT IMAGE

شکل 4- سلول های بنیادی مزانشیمی مشتق از بافت چربی تمایز یافته به غضروف (بزرگنمایی  X40)

 

در سیستم کشت پلت و سیستم کشت تک لایه اختلاف معنی‌داری داشتند (نمودار 1).  

AWT IMAGE

نمودار 1- نمودار آزمون t مستقل ارزیابی توانایی بقای سلول‌های بنیادی مزانشیمی مشتق از بافت چربی با استفاده از سیستم‌های کشت تک لایه و پلت به وسیله تست MTT. خطای معیار (SEM) برای 4 تکرار، 05/0p<، *نشان‌دهنده وجود اختلاف معنی‌دار

در این مطالعه، با استفاده از روش Real-time PCR مشخص گردید که در میزان بیان ژن‌های اگریکان و کلاژن نوع II بین سیستم کشت پلت و سیستم کشت تک لایه (سلول‌های بنیادی مزانشیمی مشتق از بافت چربی) اختلاف معنی‌داری مشاهده شد (05/0p<) اما در میزان بیان ژن sox9 و کلاژن نوع I اختلاف معنی‌داری مشاهده نشد (05/0p<) (نمودار 2).

AWT IMAGE

نمودار 2- نمودار آزمون t مستقل بررسی بیان ژن‌های مخصوص غضروف در سلول‌های بنیادی مزانشیمی مشتق از بافت چربی تمایز یافته به غضروف با استفاده از سیستم‌های کشت تک لایه و پلت به وسیله روش Real-time PCR. خطای معیار (SEM) برای 4 تکرار، 05/0p<،
 * نشان‌دهنده وجود اختلاف معنی‌دار

بحث

سلول‌های بنیادی بالغ به منظور بازسازی و مهندسی بافت غضروف به عنوان منبع مناسب سلولی به شمار می‌آیند. پتانسیل تمایز این سلول‌ها به رده غضروفی در بسیاری از سیستم‌های کشت سلول مبتنی بر داربست و عاری از داربست ارزیابی شده است [9-7]. از مهمترین سلول‌های بنیادی بالغ، سلول‌های بنیادی مزانشیمی هستند که به طور گسترده ای در مهندسی بافت غضروف مورد استفاده قرار می‌گیرند [11-10].

فرآیند غضروف سازی از سلول‌های بنیادی مزانشیمی به تراکم بالای سلول و تماس سلول- سلول در محیط تمایز به غضروف عاری از سرم به همراه TGF-β و دگزامتازون نیاز دارد [1]. گزارشات تحقیقات حاکی از آن است که جهت ایجاد بالاترین سطح تراکم سلولی در سلول‌های بنیادی مزانشیمی به تقلید از فرآیند تراکم مزانشیمی که در طول تکامل غضروف‌سازی اتفاق می‌افتد می‌توان از سیستم کشت پلت استفاده نمود [12].

امروزه، اگر چه استفاده از سیستم کشت پلت به دلیل ایجاد پدیده نامطلوب تمایززدایی، جهت کشت و تکثیر کندروسیت‌های جدا شده از غضروف مرسوم نمی‌باشد اما این سیستم به عنوان یک سیستم کشت سه بعدی به طور گسترده‌ای در مطالعات غضروف‌سازی از سلول‌های بنیادی مزانشیمی به کار رفته و قابلیت فراهم ساختن برهمکنش‌های بین سلول با سلول مناسب همچون ارتباطات سلولی که در طول تشکیل غضروف در زمان جنینی ایجاد می‌شود را نیز دارا می‌باشد. در مطالعاتی، در زمینه مهندسی بافت غضروف گزارش شد که شرایط متراکم شده می‌تواند توسط سیستم‌های کشت پلت ایجاد گردد که به عنوان محرک خارجی مناسب جهت تمایز این سلول‌ها به رده غضروفی عمل نماید. به دلیل این که تعداد زیادی سلول در سیستم کشت پلت در یک مکان تراکم یافته‌اند ناحیه مرکزی آن تحت فشار بیشتری بوده و در نتیجه برهم کنش‌های سلول- سلول بیشتری در روش کشت پلت نسبت به روش تک لایه ایجاد می‌گردد [12]. برهمکنش بین سلول- سلول نه تنها فاکتور مهمی در ایجاد مجدد عملکردهای ویژه در مهندسی بافت به شمار می‌رود بلکه در ماتریکس خارج سلولی نیز می‌تواند نقش اساسی بازی کند.

تحقیقات زیادی نشان دادند تحت شرایط خاص سلول‌های بنیادی مزانشیمی مشتق از بافت چربی توانایی بیان ژن‌ها و پروتئین‌های ویژه غضروفی شامل کلاژن نوع II و اگریکان را دارند بدون اینکه مارکرهای کندروسیتی‌ هایپرتروفیک همچون کلاژن نوع X را بیان کنند [13].

Winter و همکاران نشان دادند سلول‌های بنیادی مزانشیمی مشتق از مغز استخوان و بافت چربی، پتانسیل تمایز به غضروف را در کشت پلت نشان می‌دهند. نتایج حاصل از این مطالعه نشان داد که می‌توان از این روش جهت تمایز سلول‌های بنیادی مزانشیمی مشتق از چربی به رده غضروفی استفاده نمود که نتایج مطالعه ما نیز آن را تأیید نمود [14]. همچنین، در مطالعه‌ای با استفاده از سیستم کشت پلت، تمایز سلول‌های بنیادی مزانشیمی مشتق از چربی به رده غضروفی در مقایسه با کشت تک لایه افزایش یافت که این مطالعه نیز همسو با مطالعه ما بود [15]. دلایل این افزایش را برهم کنش بین سلول-سلول در سیستم کشت پلت دانسته اند. از مزایای این سیستم می‌توان به سطح وسیع واکنش سلول- سلول در مقایسه با کشت تک لایه اشاره نمود.

مطالعه Haudenschild و همکاران نشان داد بیان ژن‌های ویژه غضروف کلاژن نوع II و اگریکان در سیستم‌هایی همچون پلت در مقایسه با سیستم‌های کشت تک لایه افزایش بیان نشان می‌دهند [16]. در مطالعاتی مشخص شد که سلول‌های بنیادی مزانشیمی مشتق از مغزاستخوان با سیستم کشت پلت ساختار غضروفی، عملکرد و خصوصیات مولکولی برتر و بهتری را نشان می‌دهند [17]. Bernstein و همکاران نشان دادند که ژن‌های کلاژن نوع II و sox9 در کندروسیت‌های جدا شده از مفصل زانوی خوک با استفاده از سیستم کشت پلت نسبت به داربست آلژینات بیان بیشتری را نشان دادند [5].

به نظر می‌رسد که TGF-β مناسب ترین خانواده فاکتور رشد برای ساخت ماتریکس خارج سلولی باشد. TGF-β3 یکی از اعضای این خانواده نشان داد که می‌تواند به عنوان یک فاکتور غضروف سازی، تمایز غضروفی را در سلول‌های بنیادی مزانشیمی مشتق از چربی افزایش دهد [18]. نتایج حاصل از برخی مطالعات انجام شده با سیستم کشت پلت نشان داد که میانگین اگریکان در گروه تحت درمان با TGF-β3 به صورت معنی‌داری بالاتر از گروه کنترل بود [19].

مطالعه ما نشان داد تمایز سلول‌های بنیادی مزانشیمی مشتق از بافت چربی انسانی به غضروف می‌تواند تحت شرایط کشت مناسب و محیط مشخص صورت پذیرد. همچنین، غضروف سازی سلول‌های بنیادی مزانشیمی مشتق از چربی انسانی می‌تواند با استفاده از سیستم کشت پلت با اضافه نمودن محرک‌های زیست فعال خارجی همچون TGF-β3 القا شود و این مطالعه، مطالعات قبلی انجام پذیرفته را تصدیق نمود. در این مطالعه، میزان بیان ژن‌های اختصاصی غضروف شامل ژن کلاژن نوع I و II، اگریکان و sox9 سلول‌های بنیادی مزانشیمی مشتق از بافت چربی تمایز یافته به غضروف در دو سیستم کشت تک لایه و پلت نیز با روش Real-Time PCR مورد ارزیابی قرار گرفت. سطح بیان ژن‌های اگریکان و کلاژن نوع II در این مطالعه در سیستم کشت پلت در مقایسه با سیستم تک لایه افزایش معنی داری داشت. افزایش بیان ژن‌های کلاژن نوع II و اگریکان در سیستم کشت پلت در مقایسه با سیستم تک لایه نشان داد سیستم کشت پلت به منظور غضروف‌سازی سلول‌های بنیادی مزانشیمی مشتق از چربی می‌تواند ارزشمند باشد. همچنین، بیان دو ژن کلاژن نوع II و اگریکان نشان داد بافت تشکیل شده توسط این سلول‌ها، بافت غضروفی است. در این مطالعه، مشخص گردید طی کندروژنسیس در محیط سه بعدی پلت، همزمان با افزایش بیان ژن کلاژن نوع II، بیان ژن اگریکان نیز افزایش می‌یابد. تثبیت بیان mRNA از جمله ویژگی‌های اصلی سیستم کشت پلت در مقایسه با تک لایه است. در این مطالعه، حفظ بیان ژن‌های مخصوص غضروف نیز در کشت پلت سلول‌های بنیادی مزانشیمی مشتق از چربی حاصل گردید.

مهمترین محدودیت مطالعه ما این است که به دلیل عدم وجود تجهیزات و مواد لازم قادر به انجام روش‌های هیستولوژیک و ایمنوهیستوشیمی نبودیم. در این مطالعه بهتر بود رشد و تکثیر و تمایز سلول‌ها با استفاده از روش‌های هیستولوژیک و  ایمنوهیستوشیمی مورد ارزیابی قرار می‌گرفتند.

نتیجه‌گیری

این مطالعه نشان داد که با ایجاد سیستم کشت پلت در سلول‌های بنیادی مزانشیمی مشتق از بافت چربی می‌توان ضمن ایجاد ارتباط مناسب بین سلول‌ها باعث افزایش بیان در ژن‌های کلاژن II و اگریکان شده و امکان بقای سلول‌ها را افزایش داد. در نتیجه، استفاده از سیستم کشت پلت به منظور ایجاد تکثیر و تمایز به غضروف در سلول‌های بنیادی مزانشیمی مشتق از چربی توصیه می‌گردد.

تشکر و قدردانی

از جناب آقای دکتر فرهنگ و آقایان زارع و رجائی که ما را در انجام این تحقیق یاری نمودند قدردانی می‌گردد.

References

[1] Alford JW, Cole BJ. Cartilage restoration, part 1: Basic science, historical perspective, patient evaluation, and treatment options. Am J Sports Med 2005; 33:295-306.

[2] Alford JW, Cole BJ. Cartilage restoration, part 2: Techniques, outcomes, and future directions. Am J Sports Med 2005; 33: 443-60.

[3] Sheykhhasan M,  Kalhor N, Tabatabaei Qomi R, Ghiasi M. Optimization method for isolation and culture of chondrocytes in human nasal cartilage tissue. International J Advanced Biologic Sci Engineering 2014; 1(1): 74-85.

[4] Ghiasi M, Tabatabaei Qomi R, Kalhor N, Fazaeli H, Mehdizadeh M, Sheykh Hasan M. The Design of Scaffolds for Use in Tissue Engineering. SMU Med J 2014; 1(2): 261-73.

[5] Bernstein P, Dong M, Corbeil D, Gelinsky M, Gunther KP, Fickert S. Pellet culture elicits superior chondrogenic redifferentiation than alginate-based systems. Biotechnol Prog 2009; 25: 1146-52.

[6] Ghiasi M, Tabatabaei Qomi R, Nikbakht M, Sheykhhasan M. Expression of collagen type I and II, aggrecan and SOX9 genes in mesenchymal stem cells on different bioscaffolds. Tehran Univ Med J 2015; 73(3): 158-67.

[7] Zhang L, Su P, Xu C, Yang J, Yu W, Huang D. Chondrogenic differentiation of human mesenchymal stem cells: a comparison between micromass and pellet culture systems. Biotechnol Lett 2010; 32(9): 1339-46.

[8] Ichinose S, Tagami M, Muneta T, Sekiya I. Morphological examination during in vitro cartilage formation by human mesenchymal stem cells. Cell Tissue Res 2005; 322: 217–26.

[9] Lisignoli G, Cristino S, Piacentini A, Toneguzzi S, Grassi F, Cavallo C, et al. Cellular and molecular events during chondrogenesis of human mesenchymal stromal cells grown in a three-dimensional hyaluronan based scaffold. Biomaterials 2005; 26: 5677–86.

[10] Im GI, Lee JM, Kim HJ. Wnt inhibitors enhance chondrogenesis of human mesenchymal stem cells in a long-term pellet culture. Biotechnol Lett 2011; 33(5): 1061-8.

[11] Sheykhhasan M, Tabatabaei Qomi R, Kalhor N, Ghiasi M. Isolation and maintenance of canine Adipose-Derived Mesenchymal Stem Cells in order to tissue engineering application. International Journal of Advanced Biological Science and Engineering 2014; 1(2): 86-97.

[12] DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage development.Osteoarthritis Cartilage 2000; 8(5): 309-34.

[13] Mwale F, Stachura D, Roughley P, Antoniou J. Limitations of using aggrecan and type × collagen as markers of chondrogenesis in mesenchymal stem cell differentiation. J Orthop Res 2006b; 24: 1791-8.

[14] Winter A, Breit S, Parsch D, Benz K, Steck E, Hauner H, et al. Cartilage-like gene expression in differentiated human stem cell spheroids: A comparison of bone marrow–derived and adipose tissue–derived stromal cells. Arthritis & Rheumatism 2003; 48: 418-29.

[15] Hildner F, Concaro S, Peterbauer A, Wolbank S, Danzer M, Lindahl A, et al. Human adipose derived stem cells contribute to chondrogenesis in co-culture with human articular chondrocytes. Tissue Eng Part A 2009; 15: 3961-9.

[16] Haudenschild DR, McPherson JM, Tubo R, Binette F. Differential expression of multiple genes during articular chondrocyte redifferentiation. Anat Rec 2001; 263: 91-8.

[17] Cals FL, Hellingman CA, Koevoet W, Baatenburg de Jong RJ, van Osch GJ. Effects of transforming growth factor-beta subtypes on in vitro cartilage production and mineralization of human bone marrow stromal-derived mesenchymal stem cells. J Tissue Eng Regen Med 2012; 6: 68-76.

[18] Grimaud E, Heymann D, Redini F. Recent advances in TGF-β effects on chondrocyte metabolism. Potential trapeutic roles of TGF-β in cartilage disorders. Cytokine Growth Factor Rev 2002; 13: 241-57.

[19] Qiao B, Padilla SR, Benya PD. Transforming growth factor (TGF)-beta-activated kinase 1 mimics and mediates TGF-beta induced stimulation of type II collagen synthesis in chondrocytes independent of Col2a1 transcription and Smad3 signaling. J Biol Chem 2005; 280: 17562-71.


 

Introduction of Pellet Culture System of Human Adipose- Derived Mesenchymal Stem Cells as an In Vitro Model for Cartilage Engineering Approaches

R. Tabatabaei Qomi[5], M. Sheykhhasan[6], N. Kalhor[7], M. Ghiasi [8]

Received: 28/02/2015      Sent for Revision: 11/04/2015      Received Revised Manuscript: 09/05/2015     Accepted: 10/05/2015

Background and Objective: Various diseases and injuries can lead to loss cartilage tissue. Cartilage tissue engineering based on the use of stem cells which has provided a promising opportunity to repair damaged tissue. Recently, adipose-derived mesenchymal stem cells (ADSCs) have captured considerable scientific and clinic interest because of their easy access, rapid expansion in vitro and ability to differentiate into diverse cell lines. The aim of this study was to introduce the pellet culture system as an in vitro model for cartilage engineering approaches.

Materials and Methods: This experimental study was performed in Stem Cell laboratory, The Academic Center for Education, Culture and Research, Qom in 2013. In this study, ADSCs were isolated and expanded from human adipose tissue. The cells were centrifuged and the chondrogenic differentiation was performed in pellet culture system. Viability potential and chondrogenic genes expression were evaluated by MTT assay and Real-time PCR analysis, respectively. In this study, data statistical analysis was carried out by independent T-test.

Results: In this study, our obtained results using MTT assay and Real-time PCR analysis demonstrated cell survival ability and proliferation and also the expression of chondrogenic-specific genes at pellet in comparison with control group.

Conclusion: It is suggested that this method can be used for induction of chondrogenic.

Key words: Adipose-derived mesenchymal stem cells, Pellet culture system, Differentiate into chondrocyte

Funding: This research was funded by The Academic Center for Education, Culture and Research, qom-Iran.

Conflict of interest: None declared.

Ethical approval: The Ethics Committee of The Academic Center for Education, Culture and Research, qom-Iran approved the study.

How to cite this article: Tabatabaei Qomi R, Sheykhhasan M, Kalhor N, Ghiasi M. Introduction of Pellet Culture System of Human Adipose-Derived Mesenchymal Stem Cells as an in vitro Model for Cartilage Engineering Approaches. J RafsanjanUniv Med Sci 2015; 14(4): 269-82. [Farsi]

 

[1]ﻛﺎرﺷﻨﺎسی ارﺷﺪ زیست شناسی، آزمایشگاه سلول‌های بنیادی، جهاد دانشگاهی استان قم، قم، اﻳﺮان

[2]- کارشناسی ارﺷﺪ بیوتکنولوژی، آزمایشگاه سلول‌های بنیادی، جهاد دانشگاهی استان قم، قم، اﻳﺮان

[3]- ﻛﺎرﺷﻨﺎسی ارﺷﺪ ژنتیک، آزمایشگاه سلول‌های بنیادی، جهاد دانشگاهی استان قم، قم، اﻳﺮان.

[4]- (نویسنده مسئول) ﻛﺎرﺷﻨﺎسی ارﺷﺪ زیست شناسی سلولی مولکولی، آزمایشگاه سلول‌های بنیادی، جهاد دانشگاهی استان قم، قم، اﻳﺮان

    تلفن: 32700155-025، دورنگار: 32700154-025، پست الکترونیکی: Mahdieh.ghiasi@yahoo.com

  1. - MSc in Biology, Laboratory of Stem Cells, The Academic Center for Education, Culture and Research, Qom, Iran

[6]-MSc in Biotechnology, Laboratory of Stem Cells, The Academic Center for Education, Culture and Research, Qom, Iran

[7]- MSc in Genetic, Laboratory of Stem Cells, The Academic Center for Education, Culture and Research, Qom, Iran

[8]-MSc in Molecular and Cellular Biology, Laboratory of Stem Cells, The Academic Center for Education, Culture and Research, Qom, Iran

   (Corresponding Author) Tel: (025)32700155, Fax: (025)32700154, E-Mail: mahdieh.ghiasi@yahoo.com

نوع مطالعه: پژوهشي | موضوع مقاله: زيست شناسي
دریافت: ۱۳۹۳/۱۲/۴ | پذیرش: ۱۳۹۴/۲/۲۰ | انتشار: ۱۳۹۴/۴/۲

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb