جلد 14، شماره 8 - ( 8-1394 )                   جلد 14 شماره 8 صفحات 701-708 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kord Z, Amini K, Parviz M. Determining the Frequency of Panton-Valentine Leukocidin (PVL Genes), and Collagen-Binding Protein (cna) in Staphylococcus Aureus Strains Isolated from Clinical Specimens and Antibiotic Resistance: A Short Report. JRUMS. 2015; 14 (8) :701-708
URL: http://journal.rums.ac.ir/article-1-2618-fa.html
کرد زهره، امینی کیومرث، پرویز مهدی. تعیین فراوانی ژن پنتون والنتین لوکوسیدین (PVL) و پروتئین‌های متصل شونده به کلاژن Cna در سویه‌های استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی و بررسی مقاومت آنتی‌بیوتیکی: یک گزارش کوتاه. مجله دانشگاه علوم پزشکی رفسنجان. 1394; 14 (8) :701-708

URL: http://journal.rums.ac.ir/article-1-2618-fa.html


استاديار دانشگاه آزاد اسلامی، ساوه
متن کامل [PDF 176 kb]   (351 دریافت)     |   چکیده (HTML)  (1463 مشاهده)
متن کامل:   (119 مشاهده)
گزارش کوتاه

مجله دانشگاه علوم پزشکی رفسنجان

دوره 14، آبان 1394، 708-701

تعیین فراوانی ژن پنتون والنتین لوکوسیدین (PVL) و پروتئین‌های متصل شونده به کلاژن Cna در سویه‌های استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی و بررسی مقاومت آنتی‌بیوتیکی: یک گزارش کوتاه

زهره کرد[1]، کیومرث امینی[2]، مهدی پرویز[3]

دریافت مقاله: 29/1/94      ارسال مقاله به نویسنده جهت اصلاح: 9/3/94      دریافت اصلاحیه از نویسنده: 17/3/94      پذیرش مقاله: 1/4/94

چکیده

زمینه و هدف: سم ‌ پنتون ‌والنتین لوکوسیدین (PVL) یک اگزو‌توکسین همولیتیک است که باعث افزایش قدرت نفوذ‌پذیری غشاء سلولی و در نتیجه سبب لیز شدن لکوسیت‌ها و نکروز بافت می‌شود. پروتئین‌های متصل شونده به کلاژن cna ادهزین استافیلوکوکوس اورئوس است که مسئول اتصال به کلاژن و عمده‌ترین فاکتور حدت در عفونت‌های آرتریت و استئومیلیت می‌باشد. هدف از انجام مطالعه، بررسی حضور ژن‌های PVL، cna در سویه‌های استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی به روش Multiplex PCR می‌باشد.

مواد و روش‌ها: در این مطالعه توصیفی- مقطعی، تعداد 67 نمونه استافیلوکوکوس اورئوس جداسازی گردید. آزمون‌ تعیین حساسیت آنتی‌بیوتیکی بر اساس دستورالعمل CLSI با آنتی بیوتیک‌های مختلف انجام گردید. آزمون PCR چندگانه‌ نیز انجام شد.

یافته‌ها: نتایج نشان داد بیشترین حساسیت به آنتی‌بیوتیک‌های ونکومایسین و لینزولید 1/97‌% و بیشترین مقاومت به آنتی‌بیوتیک کلیندامایسین 9/23% است. فراوانی ژن cna در نمونه‌های بالینی 7/41% گزارش گردید، در صورتی که ژن PVL در هیچ یک از نمونه‌ها شناسایی نگردید.

نتیجه‌گیری: به دلیل اهمیت استافیلوکوکوس اورئوس به عنوان مهمترین عامل ایجاد عفونت در بین افراد جامعه به خصوص عفونتهای مقاوم بیمارستانی و با توجه به افزایش روزافزون مصرف آنتی‌بیوتیک‌ها، بررسی میزان مقاومت به این عوامل ضروری می‌باشد. روش PCR چندگانه‌ای یک روش ساده، حساس، کم هزینه، نسبتاً سریع و بسیار اختصاصی است که علاوه بر این، توانایی شناسایی چندین ژن را نیز به طور همزمان دارد.

واژ‌ه‌های کلیدی:  استافیلوکوکوس اورئوس،‍ لوکوسیدین پنتون والنتین

مقدمه

استافیلوکوکوس اورئوس بر روی غشاهای مخاطی و پوست پستانداران، مواد غذایی مختلف و محیط اطراف یافت می‌شود و عامل ایجاد ذات‌الریه بعد از ‌عفونت‌های ویروسی، التهاب وریدها؛ مننژیت، عفونت دستگاه ادراری؛ التهاب موضعی استخوان‌ها، اندوکاردیت، ضایعات سطحی پوست و غیره می‌باشد [1]. این باکتری دارای توکسین‌های متعدد بوده که با عملکردهای مختلف بر روی اندام هدف تأثیر می‌گذارند. سم ‌پنتون ‌والنتین لوکوسیدین PVL (Panton-Valentine leukocidin) یک اگزو‌توکسین همولیتیک است که اولین بار در سال 1930 در استافیلوکوکوس اورئوس شناسایی شد ]1[. این سم موجب افزایش قدرت نفوذ‌پذیری غشای سلولی و در نتیجه سبب لیز شدن لوکوسیت‌ها و نکروز بافت می‌شود. این سم دارای دو جزء است که هر دو جزء لوکوسیدین آنتی‌ژنیک بوده و قابل تبدیل به توکسوئید می‌باشند. این سم با ایجاد مقاومت در مقابل فاگوسیتوز قدرت تهاجمی استافیلوکوک را افزایش می‌دهد [5-1]. این سم جذب گردش خون شده و با علائم بالینی موجب گرفتاری چندین عضو مختلف می‌شود، که شامل تب، کاهش فشار خون، اسهال، درد عضلانی، پنومونی‌های نکروزدهنده و بثورات شبه مخملکی است. لوکوسیدین پنتون والنتین توسط اکثرسوش‌های استافیلوکوک اورئوس تولید می‌شود ]5[. بافت‌های غنی از کلاژن مانند استخوان‌ها و غضروف جایگاه مناسبی برای حضور استافیلوکوکوس اورئوس و ایجاد عفونتهای استافیلوکوکی می‌باشند. پروتئین‌های متصل شونده به کلاژنcna  (collagen adhesions gene) اصلی‌ترین و مهم‌ترین ادهزین استافیلوکوکوس اورئوس است که مسئول اتصال محکم به کلاژن بوده و عمده‌ترین فاکتور حدت در عفونت‌های آرتریت همراه با سپتی‌سمی و استئومیلیت می‌باشد [3]. هدف از انجام تحقیق بررسی حضور ژن‌های حدت PVL، cna در سویه‌های استافیلوکوکوس اورئوس جدا شده از نمونه‌های بالینی به روش Multiplex PCR و تعیین الگوی مقاومت آنتی‌بیوتیکی به عنوان یکی از راه‌های مهم در درمان مناسب بیماری‌های ناشی از استافیلوکوکوس اورئوس و شناسایی سویه‌های مقاوم به آنتی بیوتیک جهت تعیین راهکار مناسب درمانی می‌باشد.

مواد و روش‌ها

در این مطالعه مقطعی- توصیفی، بر اساس مطالعات قبلی و سطح اطمینان 95% با استفاده از فرمول
n=z2P (1-P)/d2 و خطای قابل قبول 05/0، تعداد 100 نمونه از بیماران مبتلا به عفونت‌های ادراری، ترشحات چرکی و مایع مغزی نخاعی از مراکز درمانی مختلف شهر تهران که به صورت تصادفی انتخاب شده بودند در سال 1392 جمع‌آوری گردید. این تعداد نمونه بر اساس میزان شیوع باکتری استافیلوکوکوس اورئوس در بین بیماران انتخاب شد. این نمونه‌ها جهت کشت بر روی محیط‌های بلاد آگار، مانیتول سالت آگار، و کروم آگار استافیلوکوکوس اورئوس انتقال داده شده و به مدت 24 ساعت در گرم خانه 37 درجه‌ سانتی‌گراد قرار داده شد. جهت تعیین هویت گونه‌های باکتری از آزمون‌های بیوشیمیایی، کوآگولاز، تست DNase و تخمیر قند مانیتول استفاده شد که در نهایت 67 جدایه‌ باکتری استافیلوکوکوس‌اورئوس‌ شناسایی‌گردید [1]. آزمون ‌آنتی‌بیوگرام با روش دیسک دیفیوژن (Disk diffusion)‌ و بر طبق ‌دستورالعمل CLSI (Clinical and Laboratory Standards Institute) انجام گردید [8]. دیسک‌های آنتی‌بیوتیک تجاری جهت ‌انجام‌ این ‌مطالعه شامل آزیترومایسین، کلیندامایسین، لینزولید، اوفلوکساسین، تیکوپلانین، ونکومایسین، متی‌سیلین،‌ (دالفوپریستین/کوینوپریستین) ازشرکت ‌HIMEDIA Himedia Laboratories Pvt.Limited-INDIA) ) تهیه گردید. جهت بررسی کنترل کیفی آزمایشات از سویه استاندارد استافیلوکوکوس اورئوس ATCC 25923 به عنوان کنترل مثبت استفاده شد. برای استخراج DNA از کیت باکتریهای گرم مثبت سیناژن (Cinna Pure DNA KIT-PR881614) استفاده گردید. برنامه آزمون Multiplex-PCR : مرحله واسرشت اولیه 94 درجه سانتی‌گراد به مدت 4 دقیقه، مرحله واسرشت 94 درجه سانتی‌گراد به مدت 2 دقیقه، مرحله اتصال 58 درجه سانتی‌گراد به مدت 1 دقیقه، مرحله بسط 72 درجه سانتی‌گراد به مدت 2 دقیقه (تعداد 31 سیکل)، مرحله بسط نهایی 72 درجه سانتی‌گراد به مدت 5 دقیقه می‌باشد. توالی پرایمرهای مورد استفاده در این آزمون شامل: PVL-F: ATGTCTGGACATGATCCAA و
:AACTATCTCTGCCATATGGT PVL-R با طول باند 970bp جهت شناسایی ژن پنتون‌والنتین لوکوسیدین، پرایمرهای ACACCAGACGGTGCAACAATTACna-1: و AGCATTACCGTTTGCATCTGTTA  Cna-2: با طول باند bp 815 جهت شناسایی ژن پروتئین‌های متصل شونده به کلاژن، بوده است ]7[. مخلوط‌های استفاده شده جهت انجام واکنش به این شرح می‌باشد: Master Mix سیناژن (PR8251C) به میزان 5/12 میکرولیتر، آب مقطر 5/7 میکرولیتر، پرایمرهای مورد استفاده هرکدام 5/0 میکرولیتر، نمونه DNA 3 میکرولیتر در حجم نهایی25 میکرولیترتهیه گردید ]7[. آزمون Multiplex-PCR در دستگاه ترموسایکلر(BIORAD) انجام شد. جهت بررسی محصول Multiplex-PCR نمونه‌ها بر روی ژل آگارز 1% انتقال داده شده و بعد از رنگ‌آمیزی در دستگاه ژل داک BIORAD)) مورد بررسی قرارگرفت. داده‌های آماری با نرم‌افزار SPSS نسخه 13و با استفاده از آزمون‌های آماری توصیفی کای اسکوئر مورد تجزیه و تحلیل آماری قرار گرفت.

نتایج

این تحقیق بر روی67 ایزوله استافیلوکوکوس‌اورئوس جداسازی شده انجام گرفت. میزان حساسیت سویه‌های مختلف به آنتی‌بیوتیک‌های مورد استفاده در جدول 1 ذکر شده است.

بیشترین حساسیت به آنتی‌بیوتیک ونکومایسین و لینزولید 1/97% و بیشترین مقاومت به آنتی‌بیوتیک کلیندامایسین 9/23% گزارش شده است. در صورتی که میزان حساسیت به آنتی‌بیوتیک متی‌سیلین به میزان 1/79% مشاهده شد. نتایج مولکولی نشان داد که فراوانی ژن Cna در 28 نمونه برابر با 7/41% بوده و ژن PVL در هیچ یک از نمونه‌ها شناسایی نگردید و مجموع 67 نمونه فاقد این ژن بودند. همچنین، نتایج آزمون ملکولی در شکل 1 بر اساس شناسایی ژن‌های مورد نظر با طول باند هر ژن ذکر شده است.

 

جدول 1- میزان حساسیت سویه‌های جداسازی شده به آنتی‌بیوتیک‌های مختلف با روش دیسک دیفیوژن

آنتی بیوتیک‌ها

مقاوم

(درصد) تعداد

نیمه حساس

(درصد) تعداد

حساس

(درصد) تعداد

کلیندامایسین

 16(9/23)

-

51 (1/76)

ونکومایسین

 2(9/2)

-

 65(1/97)

تیکوپلانین

 3(5/4)

-

 64(5/95)

لینزولید

 2(9/2)

-

 65(1/97)

افلوکساسین

-

(9/20%) 14

(1/79) 53

آزیترومایسین

 14(9/20)

-

 53(1/79)

متی‌سیلین

 14(9/20)

-

 53(1/79)

دالفوپریستین/کوینوپریستین

 3(5/4)

-

 64(5/95)

AWT IMAGE

شکل 1- الکتروفورز محصول PCR بر روی ژل آگارز

نتایج M-PCR از سمت چپ به ترتیب: ستون مارکر 100bp، کنترل مثبت، کنترل منفی، نمونه‌های 2-3-5-6- حاوی ژن cna می‌باشند.

بحث

استافیلوکوکوس‌اورئوس که به عنوان دومین پاتوژن بیمارستانی محسوب می‌شود، به طیف وسیعی از آنتی‌بیوتیک‌ها مقاوم می‌باشد. Najar peerayeh و همکاران تحقیقی با عنوان شناسایی استافیلوکوکوس اورئوس مقاوم به متی‌سیلین از طریق انتشار دیسک و PCR و بررسی الگوی مقاومتی آن انجام داده و به این نتیجه رسیدند که استافیلوکوکوس اورئوس از جمله عوامل مهم ایجاد عفونت‌های شدید بوده و سویه‌های مقاوم به متی‌سیلین این باکتری بیشترین عامل مرگ و میر در بیمارستان‌ها می‌باشند، لذا درمان و شناسایی سریع سویه‌های مقاوم به متی‌سیلین دارای اهمیت می‌باشد ]6[. مقایسه تحقیق حاضر با سایر مطالعات نشان می‌دهد میزان مقاومت سویه‌ها به آنتی‌بیوتیک‌های متی‌سیلین و کلیندامایسین به مراتب کمتر از سایر مطالعات انجام شده می‌باشد. همچنین، با توجه به الگوی به دست آمده تنها 2 سویه نسبت به ونکومایسین از خود مقاومت نشان داد که می‌توان گفت 1/97% سویه‌ها نسبت به ونکومایسین حساس می‌باشند و این آنتی‌بیوتیک هنوز کارایی لازم برای درمان عفونت‌های حاصل از سویه‌های استافیلوکوکوس اورئوس مقاوم به متی‌سیلین MRSA (Methicillin Resistance Staphylococcus aureus ) را دارا می‌باشد، ولی100% نبودن کارایی این آنتی‌بیوتیک یک علامت هشدار، برای یافتن آنتی بیوتیک‌های جدید و کارآمدتر می‌باشد. جهت کاهش مقاومت آنتی‌بیوتیکی باید دو فاکتور عمده یعنی استفاده زیاد از آنتی‌بیوتیک‌ها و سهولت گسترش ژن مقاومت را نیز در نظر داشت.

Patti و همکاران با بررسی بیان ژن Cna در استافیلوکوکوس اورئوس به نقش اصلی این ژن در ایجاد بیماریهای استخوانی و مفاصل در بیماران حامل باکتری استافیلوکوکوس اورئوس که دارای این ژن می‌باشند اشاره می‌کند ]3[. Sapri و همکاران با استفاده از روش Multiplex-PCR به شناسایی ژن‌های حدت استافیلوکوکوس اورئوس‌ مقاوم به متی‌سیلین (TSST-1,PVL,seh,cna) پرداختند. در این تحقیق فراوانی ژن cna (59/51%)، ژن seh(82/21%)، PVL (23/10%) و TSST-1(82/6%) گزارش گردید ]7[. در نتایج پژوهش ما نیز فراوانی ژن Cna از بین مجموع نمونه‌ها 7/41% بوده است. ژن پنتون والنتین لوکوسیدین PVL یک فاکتور واگیرداری است که همراه با عفونت MRSA است و کشف آن زمان زیادی را به خود اختصاص می‌دهد که بستگی به محیط کشت آن دارد. با توجه به مطالعاتی که صورت گرفته درصد فراوانی ژن سم پنتون والنتین لوکوسیدین PVL در سویه‌های مقاوم به متی‌سیلین بیشتر است ]5[. بنابراین تحقیق ما هیچ یک از نمونه‌ها حاوی ژن PVL نبوده و این ژن شناسایی نگردید. با توجه به نتایج حاصل از آزمایش دیسک دیفیوژن و مقایسه آن با الگوی استاندارد، بیشتر ایزوله‌های جدا شده مورد بررسی، نسبت به متی‌سیلین حساس بوده و نشان دهنده عدم بروز ژن PVL در سویه‌های مورد بررسی می‌باشد، که تأییدکننده این مطلب است که برای بروز ژن pvl و ایجاد مقاومت، حضور ژن mec A ضروری است ]5[. همچنین Martinez و همکاران با بررسی بر روی کودکان عفونی آلوده به استافیلوکوکوس اورئوس به این نتیجه دست یافتند که میزان شناسایی ژن pvl با روش ملکولی در کودکانی که به متی‌سیلین مقاوم بوده‌اند به مراتب از سایر کودکان که به آنتی‌بیوتیک متی‌سیلین حساسیت نشان داده‌اند بیشتر بوده است ]4[. طی تحقیقی Enany و همکاران در مصر نیز مشخص گردید که، علیرغم انتشار جهانی حضور ژن pvl در استافیلوکوکوس اورئوس مقاوم به متی‌سیلین (مقاومت اکتسابی)، این ژن در کشور مصر شناسایی نگردید. و pvl یک مارکر خوب برای شناسایی این سویه‌ها می‌باشد ]2[. مقایسه این نتایج با پژوهش اخیر مؤید این مطلب می‌باشد که عدم جداسازی ژن pvl در نمونه‌های بالینی با توجه به نتایج آزمون آنتی‌بیوگرام، با میزان بالای حساسیت به آنتی‌بیوتیک متی‌سیلین در عدم شناسایی این ژن ارتباط معناداری دارد.

نتیجه‌گیری

با توجه به فراوانی ژن Cna به عنوان یک ادهزین در باکتری استافیلوکوکوس اورئوس در این تحقیق که می‌تواند در ایجاد ضایعات و آسیب‌های مفصلی و استخوانی در بیمارانی آلوده به این باکتری نقش مهمی ایفا نماید، جداسازی مستمر و انجام آزمون‌های مولکولی جهت شناسایی این ژن در ردیابی منابع آلوده کننده ضروری می‌باشد. با استفاده از روشMultiplex PCR  می‌توان در کوتاه‌ترین مدت زمان با ویژگی و حساسیت بالا به حضور ژن‌های بیماری‌زا پی برد و با شناسایی سویه‌های مقاوم و راه‌های انتقال این ژن‌ها در جمعیت‌های انسانی اقدامات پیشگیرانه را انجام داد. اقدامات کنترل عفونت و رعایت نکات بهداشتی در بین کارکنان بیمارستانی و ضدعفونی لوازم و تجهیزات بیمارستانی در حذف یا کاهش این نوع سویه‌ها باید بسیار جدی گرفته شود.

تشکر و قدردانی

از کارکنان آزمایشگاه پژوهشی میکروبیولوژی پاسارگاد مهندس ابوالفضل مقدم، رامین خاکی جوان که در انجام مراحل عملی این تحقیق یاری نمودند تشکر و سپاسگزاری می‌گردد.

References

[1] Gillespie SH, Hawkey PM. Principles and Practice of Clinical Bacteriology. Second Edition. England. John Wiley & Sons Ltd 2006; 73-89.

[2] Enany S, Yaoita E, Yoshida Y, Enany M, Yamamoto T. Molecular characterization of Panton-Valentine leukocidin-positive community-acquired Methicillin-Resistant Staphylococcus aureus isolates in Egypt. Microbiol Re 2010; 165(2): 152-62.

[3] Patti JM, Jonsson H, Guss B, et al. Molecular characterization and expression of a gene encoding a Staphylococcus aureus collagen adhesin. J Biol Chem 1992; 267(7): 4766-72.

[4] Martínez-Aguilar G, Avalos-Mishaan A, Hulten K, Hammerman W, Mason Jr EO, Kaplan SL. Community-acquired, Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus musculoskeletal infections in children. Pediatr Infect Dis J 2004; 23(8): 701-6.

[5] McClure JA, Conly JM, Lau V, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci. J Clin Microbiol 2006; 44(3): 1141-4.

[6] Najar Peerayeh S, Azimian A, Mostafaee M, Siadat SD. Identification of Methicillin-Resistant Staphylococcus aureus by Disk Diffusion method determination of MIC and PCR for mecA gene. Modares J Med Sci Pathobiology 2009; 12(3): 61-9. [Farsi]

[7] Sapri HF, Sani NAM, Neoh H-m, Hussin S. Epidemiological Study on Staphylococcus aureus Isolates Reveals Inverse Relationship between Antibiotic Resistance and Virulence Repertoire. Indian j Pathol Microbiol 2013; 53(3): 321-2.

[8] Cockerill FR. Performance standards for antimicrobial disk susceptibility testing. Approved Standard Eleventh Edition M02-A11. CLSI 2012; 32(1).


 

Determining the Frequency of Panton-Valentine Leukocidin (PVL Genes), and Collagen-Binding Protein (cna) in Staphylococcus Aureus Strains Isolated from Clinical Specimens and Antibiotic Resistance: A Short Report

Z. Kord[4], K. Amini[5], M. Parviz[6]

Received: 18/04/2015      Sent for Revision: 30/05/2015      Received Revised Manuscript: 07/06/2015     Accepted: 22/06/2015

Background and Objective: Panton-Valentine leukocidin (PVL) toxin is a hemolytic exotoxin that increases the permeability of the cell membrane, thus causing lysis of leukocytes and tissue necrosis. Collagen-binding protein (Cna) adhesion Staphylococcus aureus is responsible for binding to collagen and the major virulence factor in arthritis and osteomyelitis. The purpose of this study was to investigate the presence of antibiotic resistance and virulence genes for PVL, Cna in Staphylococcus aureus strains isolated from clinical specimens by Multiplex PCR.

Materials and Methods: In this cross-sectional, descriptive study, 67 samples of Staphylococcus aureus were isolated. Based on CLSI antimicrobial susceptibility guidline, different antibiotics were tested. Multiplex PCR assay was performed.

Results: Finndings showed that the susceptibility to vancomycin and linezolid antibiotics was 97.1% and maximum resistance is to clindamycin was 23.9%. the frequency of Cna gene in clinical samples was 41.7% while PVL genes were not detected in the samples.

Conclusion: Because of the importance of methicillin resistance Staphylococcus aureus as the cause of infection among people, especially resistant hospital infections, due to increasing use of antibiotics, knowledge of the level of resistance to these agents is essential. Multiplex PCR is a simple, sensitive, inexpensive, relatively quick and very specific in addition, it has an ability to identify multiple genes simultaneously.

Key words: Staphylococcus aureus, Panton -Valentine leukocidin, Cna, Multiplex PCR

Funding: This research was funded by Saveh Science and Research Branch, Islamic Azad University, Saveh, Iran

Conflict of interest: None declared.

Ethical approval: The Ethics Committee of Saveh Science and Research Branch, Islamic Azad University approved the study.

How to cite this article: Kord Z, Amini K, Parviz M. Determining the Frequency of Panton-Valentine Leukocidin (PVL), and Collagen- Binding protein (can) in Staphylococcus Aureus Strains Isolated from Clinical Specimens and Antibiotic Resistance: A Short Report. J RafsanjanUniv Med Sci 2015; 14(8): 701-8. [Farsi]

 

[1]- دانش‌آموخته کارشناسی‌ ارشد، گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران

[2]- استادیار گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران

   تلفن: 42241511-086، دورنگار: 42241511-086، پست الکترونیکی: kamini@iau-saveh.ac.ir

[3]- مربی گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران

  1. - MSc in Microbiology, College of Saveh Science and Research Branch, Islamic Azad University, Saveh, Iran

[5]- Assistant Prof., Dept. of Microbiology, Saveh Branch, Islamic Azad University, Saveh, Iran

  (Corresponding Author) Tel: 086-42241511, Fax: 086-42241511, E-mail: kamini@iau-saveh.ac.ir

[6]-Academic Member Dept. of Microbiology, Saveh Branch, Islamic Azad University, Saveh, Iran

نوع مطالعه: پژوهشي | موضوع مقاله: ميكروبيولوژي
دریافت: ۱۳۹۴/۱/۲۴ | پذیرش: ۱۳۹۴/۴/۱۰ | انتشار: ۱۳۹۴/۸/۲۴

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb