جلد 16، شماره 3 - ( 3-1396 )                   جلد 16 شماره 3 صفحات 191-202 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Aminizadeh S, Habibi A, Marefati H, Shakerian S. The Role of Pyruvate Dehydrogenase Kinase 4 (PDK4) on the Expression of Citrate Synthase in the Skeletal Muscle After 4 Weeks of Endurance Training in Male Wistar Rats . JRUMS. 2017; 16 (3) :191-202
URL: http://journal.rums.ac.ir/article-1-3660-fa.html
امینی زاده سهیل، حبیبی عبدالحمید، معرفتی حمید، شاکریان سعید. بررسی نقش پیروات دهیدروژناز کیناز 4 (PDK4) بر بیان سیترات سنتاز در عضله اسکلتی متعاقب چهار هفته تمرین استقامتی در موش‌های نر نژاد ویستار. مجله دانشگاه علوم پزشکی رفسنجان. 1396; 16 (3) :191-202

URL: http://journal.rums.ac.ir/article-1-3660-fa.html


دانشیار گروه فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه شهید باهنر کرمان، کرمان، ایران
متن کامل [PDF 218 kb]   (625 دریافت)     |   چکیده (HTML)  (957 مشاهده)
متن کامل:   (307 مشاهده)
مقاله پژوهشی

مجله دانشگاه علوم پزشکی رفسنجان

دوره 16، خرداد 1396، 202-191

بررسی نقش پیروات دهیدروژناز کیناز 4 (PDK4) بر بیان سیترات سنتاز در عضله اسکلتی متعاقب چهار هفته تمرین استقامتی در موش‌های نر نژاد ویستار

سهیل امینی‌زاده[1]،[2]، عبدالحمید حبیبی[3]، حمید معرفتی[4] ،[5] ، سعید شاکریان[6]

دریافت مقاله: 14/12/95    ارسال مقاله به نویسنده جهت اصلاح: 13/2/96    دریافت اصلاحیه از نویسنده: 26/2/96      پذیرش مقاله: 7/3/96

AWT IMAGEچکیده

زمینه و هدف: حفظ تعادل بین نیاز و فراهمی انرژی برای حفظ سلامتی حیاتی است. در این فرایند، آنزیم پیروات دهیدروژناز کیناز 4 ](PDK4)[Pyruvate dehydrogenase kinase  در حفظ هومئوستاز انرژی نقش مهمی ایفا می‌کند. لذا هدف از پژوهش حاضر، بررسی نقش PDK4 بر بیان سیترات سنتاز در عضله اسکلتی متعاقب چهار هفته تمرین استقامتی در موش‌های نر نژاد ویستار بود.

مواد و روش‌ها: مطالعه حاضر از نوع تجربی بوده و تعداد 32 موش نر نژاد ویستار به‌صورت تصادفی به چهار گروه کنترل (8n=)، گروه کنترل+دی کلرواستات (8n=)، گروه تمرین استقامتی (8n=) و تمرین استقامتی+دی کلرواستات (8n=) تقسیم شدند. مهار PDK4 با تزریق درون صفاقی و روزانه دی کلرواستات (Dichloroacetate; DCA) به میزان 150 میلی‌گرم در هر کیلوگرم وزن بدن انجام گرفت. تمرین استقامتی دویدن به مدت 4 هفته (5 جلسه در هر هفته)، شروع با سرعت 15 متر بر دقیقه و زمان 20 دقیقه و رسیدن به سرعت 27 متر بر دقیقه به مدت 50 دقیقه بر گروه‌های تمرینی اعمال شد. بیان ژن‌ها با روش PCR Real-Time اندازه‌گیری شد. از تحلیل واریانس یک‌طرفه و آزمون تعقیبی Tukey برای مقایسات بین گروهی استفاده شد.

یافته‌ها: بیان ژن PDK4 (001/0P=) و سیترات سنتاز (025/0P=) در گروه تمرین استقامتی در مقایسه با گروه کنترل بیشتر بود. بیان ژن PDK4 در گروه تمرین استقامتی+DCA در مقایسه با گروه کنترل بیشتر بود (001/0P=) ولی بیان سیترات سنتاز در گروه تمرین استقامتی+DCA در مقایسه با گروه کنترل کمتر بود (016/0P=).

نتیجه‌گیری: آنزیم PDK4 که باعث تغییر منبع انرژی مورد استفاده از گلوکز به چربی‌ها می‌شود، احتمالاً می‌تواند در تنظیم آنزیم‌های کلیدی در چرخه کربس و اکسیداسیون گلوکز نیز نقش داشته باشد.

واژه‌های کلیدی: انعطاف‌پذیری متابولیکی، تمرین استقامتی، پیروات دهیدروژناز کیناز 4، موش

مقدمه

انعطاف‌پذیری متابولیکی ظرفیت یک سیستم برای تنظیم اکسیداسیون منابع انرژی (عمدتاً گلوکز و اسیدهای چرب) بر اساس میزان دسترسی به این مواد سوختی است. رقابت بین اسیدهای چرب و گلوکز برای ورود به مسیرهای متابولیکی اکسیداسیون در بافت عمدتاً در سطح عملکرد ترکیب پیروات دهیدروژناز (Pyruvate dehydrogenase complex; PDC) رخ می‌دهد [1] که در نتیجه آن، قند، چربی و مشتقات آن، به‌عنوان منابع سوختی سلولی، می‌توانند با یکدیگر رقابت و بر اکسیداسیون یکدیگر اثر متقابل بگذارند [2]. سازگاری‌های متابولیکی اصلی عضله اسکلتی به تمرین استقامتی، استفاده کمتر از کربوهیدرات‌ها، تکیه بیشتر بر روی منابع انرژی چربی و تولید لاکتات کمتر در طول تمرین با شدت کم تا متوسط (مثلاً: 65-45 درصد حداکثر اکسیژن دریافتی) است که این سازگاری‌ها در مجموع، افزایش در ظرفیت تمرینی زیر بیشینه را به دنبال تمرین استقامتی پشتیبانی می‌کنند [4-3].

تنظیم فعالیت PDC بخشی مهم در تنظیم هومئوستاز گلوکز است، به‌طوری‌که فعالیت PDC دسترسی به گلوکز را افزایش می‌دهد [5]. غیرفعال شدن PDC توسط 4 ایزوآنزیم پیروات دهیدروژناز کیناز [Pyruvate dehydrogenase kinase; PDK] کاتالیز می‌شود [6-7]. PDK4 آنزیمی است که در کنترل مصرف سوبسترا و فسفوریله کردن PDC و غیرفعال کردن آن درگیر است و بنابراین باعث تغییر اکسیداسیون سوبسترا از کربوهیدرات‌ها به سمت چربی‌ها می‌شود [8].  PDK4 به‌وفور در جزایر پانکراس، قلب و عضله اسکلتی یافت می‌شود که این بافت‌ها مصرف گلوکز بالا و نرخ اکسیداسیون اسید چرب بالایی دارند [9, 1].

آنزیم کلیدی تنظیمی دیگری که در مسیر متابولیکی تولید انرژی وجود دارد سیترات سنتاز است که به‌طورمعمول به‌عنوان مارکری برای اندازه‌گیری ظرفیت هوازی و چگالی میتوکندریایی در عضله اسکلتی است [10-11]. همچنین، ارزیابی‌های مستقیم بیش‌تنظیمی mRNA سیترات سنتاز در رت‌ها نشان می‌دهد که افزایش رونویسی ژن سیترات سنتاز بلافاصله بعد از تمرین اتفاق نمی‌افتد و معمولاً 3 ساعت بعد از تمرین حاد و یا 24 ساعت بعد از تمرین اتفاق می‌افتد [12].

در این زمینه، Dohm و همکاران دریافتند که یک هفته بعد از تمرین حاد میزان سیترات سنتاز افزایش می‌یابد، اما افزایش معنی‌داری در mRNA سیترات سنتاز مشاهده نشد که نشان می‌دهد افزایش سیترات سنتاز به‌وسیله سیگنالینگ مولکولی القاء می‌شود [13]. بیان PDK4 در عضله اسکلتی در پاسخ به همه پروتکل‌های تمرینی افزایش می‌یابد، اما این افزایش در تمرینات استقامتی در مقایسه با تمرینات تک‌جلسه‌ای بیشتر است. برای مثال، Wang و همکاران دریافتند که در افراد تمرین‌نکرده پاسخ 2/2 برابری در بیان PDK4 متعاقب تمرینات مقاومتی و تمرین استقامتی متقارن (Concurrent endurance) نسبت به تمرین استقامتی تک‌جلسه‌ای بروز می‌یابد [14].

علی‌رغم نقش کلیدی PDK4 و سیترات سنتاز در فرایندهای متابولیکی (1)، تاکنون تحقیقی که به‌طور هم‌زمان عملکرد متقابل این دو فاکتور را به‌عنوان آنزیم‌های کلیدی و محدودکننده در چرخه کربس متعاقب تمرین استقامتی مورد ارزیابی قرار دهد، انجام نشده است، تا بتوان مدارکی را برای رد یا تأیید ارتباط متقابل این دو فاکتور نشان داد. لذا، هنوز ارتباط بین این دو فاکتور و تأثیر متقابل آن‌ها بر روی متابولیسم کربوهیدرات‌ها مشخص نیست. بنابراین هدف اول تحقیق حاضر بررسی تأثیر تمرین استقامتی طولانی‌مدت بر سطوح mRNA، سیترات سنتاز و  PDK4است و هدف دوم از تحقیق حاضر بررسی اشتراک PDK4 در متابولیسم کربوهیدرات‌ها با تأکید بر آنزیم کلیدی سیترات سنتاز با مهار کردن PDK4 می‌باشد.

مواد و روش‌ها

تحقیق حاضر از نوع تجربی بوده و 32 سر موش صحرایی نر نژاد ویستار در سن هشت هفتگی در محدوده وزنی 10±200 گرم در تابستان سال 1395 از مرکز تحقیقات فیزیولوژی کرمان خریداری و به حیوان‌خانه مرکز تحقیقات قلب و عروق دانشگاه علوم پزشکی کرمان منتقل شدند. حیوانات در شرایط دمایی 2±22 درجه سانتی‌گراد تحت شرایط 12:12 ساعت تاریکی-روشنایی و رطوبت 50 درصد نگه‌داری شدند و با غذای مخصوص رت (شرکت جوانه خراسان) و آب تغذیه شدند (کد اخلاقی: IR.KMU.REC.1394.449). بعد از یک هفته و آشنایی با محیط آزمایشگاه، رت‌ها بر اساس وزن همسان‌سازی و به‌طور تصادفی به چهار گروه کنترل (8n=)، گروه کنترل+دی کلرواستات (8n=)، گروه تمرین استقامتی (8n=) و تمرین استقامتی+دی کلرواستات (8n=) تقسیم شدند. در تحقیق حاضر جهت مهار PDK4 در عضله اسکلتی از تزریق درون صفاقیDCA  به مقدار 150 میلی‌گرم در هر کیلوگرم وزن بدن در روز در محلول نرمال سالین استفاده شد [15].

پروتکل تمرینی به مدت چهار هفته (پنج روز در هر هفته) انجام شد. ابتدا، گروه‌های تمرینی به مدت 5 روز با دستگاه تردمیل (مدل LE7800، ساخت شرکت Harvard Apparatus، فرانسه) با سرعت 15 متر بر دقیقه به مدت 20 دقیقه آشناسازی شدند. سپس مدت‌زمان و سرعت به‌تدریج در طول چهار هفته افزایش یافت، به‌طوری‌که در هفته پایانی سرعت به 27 متر بر دقیقه و زمان تمرین به 50 دقیقه در هر روز رسید که شدتی معادل با 75 درصد حداکثر اکسیژن مصرفی بود. گروه‌های کنترل در طول دوره تمرین در قفس‌ها بدون تمرین نگه داشته شدند [16] (جدول 1).

جدول 1- پروتکل تمرینی اعمال‌شده

هفته

هفته اول آشناسازی

 1

2

3

4

سرعت (متر بر دقیقه)

15

22

25

27

27

مدت (دقیقه)

20

35

40

45

50

72 ساعت پس از آخرین جلسه تمرینی، 32 سر موش از طریق تزریق درون صفاقی کتامین (90 میلی‌گرم در هر کیلوگرم وزن بدن) و زایلازین (10 میلی‌گرم در هر کیلوگرم وزن بدن) بی‌هوش و عضله دوقلو میانی بلافاصله جدا شد و در نیتروژن مایع منجمد و برای تجزیه و تحلیل بعدی به دمای 80- درجه سانتی‌گراد منتقل شد ]16[.

به‌منظور استخراج mRNA، از Isol-RNA Lysis Reagent استفاده شد. تقریباً 100 میلی‌گرم بافت عضله دوقلو میانی با روش‌هاون کوبی پودر و در یک میلی‌لیتر Isol-RNA Lysis Reagent هموژن شد. سپس، میکروتیوب‌های 2 سی‌سی (شرکت unique، کشور آلمان) در دور 12000 جی به مدت 10 دقیقه و در دمای 4 درجه سانتی‌گراد سانتریفیوژ (دستگاه سانتریفیوژ یخچال‌دار، مدل 5430R، شرکت Eppendorf، ساخت آلمان)، سوپرناتانت جدا و به میکروتیوب جدید منتقل شد. در مرحله بعدی، کلروفرم به میزان 200 میکرولیتر به سوپرناتانت اضافه و 15 ثانیه با شدت زیاد تکان داده شد. سپس، میکروتیوب‌ها در دور 12000 جی به مدت 15 دقیقه و در دمای 4 درجه سانتی‌گراد مجدداً سانتریفیوژ شدند. فاز آبی نمونه‌ها برداشت شد و به آن 600 میکرولیتر ایزوپروپانول اضافه شد و mRNA طبق دستورالعمل شرکت سازنده استخراج شد. غلظت RNA و خلوص آن به‌وسیله کنترل نسبیت 280/260 OD محاسبه (دستگاه نانو دراپ، مدل AmpliQuant AQ-07، ساخت آمریکا) و مقادیر بین 8/1 تا 2 به‌عنوان خلوص قابل‌قبول تعریف شد [16].

با استفاده از کیت سنتز  cDNAشرکت تاکارا
(
TaKaRa) طبق دستورالعمل شرکت سازنده انجام شد. بیان ژن‌های موردنظر با روش PCR Real-Time و با دستگاه Real-Time PCR مدل Step One Plus کمپانی ABI (Applied Biosystems) آمریکا اندازه‌گیری شد و با روش AWT IMAGE کمی‌سازی شدند [17]. واکنش‌های PCR با استفاده از RealQ Plus 2x Master Mix Green High ROX شرکت امپلیکن انجام شد. برنامه Real-Time PCR شامل واسرشت اولیه در دمای 95 درجه سانتی‌گراد به مدت سه دقیقه، 40 سیکل شامل واسرشت در هر سیکل با دمای 95 درجه سانتی‌گراد به مدت 22 ثانیه، بسط در دمای 95 درجه سانتی‌گراد به مدت 45 ثانیه انجام شد. از 18S به‌عنوان ژن مرجع برای سنجش بیان ژن نسبی و به‌منظور کنترل تکثیر تخصصی محصول از آنالیز منحنی ذوب استفاده گردید. توالی پرایمرهای مورداستفاده در تحقیق در جدول 2 گزارش شده است [18].

جدول 2- توالی پرایمر

اندازه (bp)

Reverse primer

5´-3´

Forward primer

5´-3´

ژن

123

100

107

GGCCTCACTAAACCATCCAA

GAAGCCTGGGATGCTCTTG

CAAGACCACCACAACTCTCC

GCAATTATTCCCCATGAACG

AAGCCCTGATGGACACCTC

CGCCCCAGACTACGATAAAA

18S

PDK4

CS

برای تجزیه و تحلیل داده‌ها از نرم‌افزارSPSS  نسخه 22 استفاده شد. داده‌ها به‌صورت انحراف معیار± میانگین گزارش شدند. در قسمت آمار استنباطی از آزمون Shapiro-Wilk برای تعیین توزیع طبیعی داده‌ها (12/0P=) و از آزمون Levene برای تعیین همگنی واریانس‌ها استفاده شد. در تحقیق حاضر، در آزمون لوین مقدار 126/0 P=برای فاکتور سیترات سنتاز و 079/0P= برای فاکتور PDK4 به دست آمد که نشان‌دهنده همگنی واریانس‌ها است. برای مقایسه بین میانگین داده‌ها در گروه‌های مختلف (8n=) از تحلیل واریانس یک‌طرفه و آزمون تعقیبی Tukey استفاده شد و در تمام آزمون‌های آماری سطح معناداری 05/0 در نظر گرفته شد [16].

نتایج

میانگین بیان ژن PDK4 در گروه تمرین استقامتی (001/0P=) و گروه کنترل+DCA (001/0P=) در مقایسه با گروه کنترل به‌طور معنی‌داری بیشتر بود. بیان ژن PDK4 در گروه تمرین استقامتی+DCA در مقایسه با گروه کنترل بیشتر بود (001/0P=). بیان PDK4 در گروه تمرین استقامتی در مقایسه با گروه تمرین استقامتی+DCA تفاوت معناداری نشان نداد (512/0P=) (نمودار 1).

AWT IMAGE

نمودار 1- بیان نسبی PDK4 در گروه‌های مختلف موش‌های نر نژاد ویستار

گروه کنترل (8n=)، گروه کنترل +دی‌کلرواستات (8n=)، گروه تمرین استقامتی (8n=) و تمرین استقامتی+ دی‌کلرواستات (8n=)

آنالیز واریانس یک‌طرفه، * 05/0 اختلاف معنی‌دار در مقایسه با گروه کنترل

میانگین بیان ژن سیترات سنتاز در گروه تمرین استقامتی در مقایسه با گروه کنترل بیشتر بود (025/0P=). بیان سیترات سنتاز در گروه تمرین استقامتی+DCA (016/0P=) و گروه کنترل+DCA (026/0P=) در مقایسه با گروه کنترل کمتر بود. بیان سیترات سنتاز در گروه تمرین استقامتی در مقایسه با گروه تمرین استقامتی+DCA به‌طور معناداری بیشتر بود (001/0P=) (نمودار 2).

AWT IMAGE

نمودار 2- بیان نسبی سیترات سنتاز در گروه‌های مختلف موش‌های نر نژاد ویستار

گروه کنترل (8n=)، گروه کنترل +دی‌کلرواستات (8n=)، گروه تمرین استقامتی (8n=) و تمرین استقامتی+ دی‌کلرواستات (8n=)

آنالیز واریانس یک‌طرفه، * 05/0 اختلاف معنی‌دار در مقایسه با گروه کنترل

¥ 05/0 اختلاف معنی‌دار در مقایسه با گروه تمرین استقامتی

بحث

پژوهش حاضر به‌منظور بررسی اثرات بلندمدت تمرین استقامتی بر بیان ژن‌های PDK4 و سیترات سنتاز در عضله دوقلوی میانی موش‌های نر نژاد ویستار و تعیین نقش PDK4 بر آنزیم کلیدی چرخه کربس (سیترات سنتاز) متعاقب تمرین استقامتی انجام شد. مهم‌ترین نتایج به‌دست‌آمده این بود که متعاقب تمرین استقامتی، بیان PDK4 و سیترات سنتاز هم‌راستا با یکدیگر افزایش می‌یابند و با مهار PDK4 در عضله اسکلتی بیان سیترات سنتاز هم در گروه تمرین استقامتی +دی‌کلرواستات و هم در گروه کنترل+ دی‌کلرواستات در عضله اسکلتی کاهش می‌یابد.

در پژوهش حاضر از DCA که یک اسید کربوکسیلیک‌ هالوژنه است و منجر به افزایش فعالیت PDC در عضلات اسکلتی حیوان [19] و انسان [20-21] و مهار PDK4 می‌شود، استفاده شد که این عمل را به‌طور رقابتی با مهار PDK2 و PDK4 انجام می‌دهد [15]. DCA به‌عنوان یک فعال‌کننده PDC شناخته می‌شود [22]. همچنین به دلیل ضرورت دریافت داروی DCA جهت القای مهار PDK4 به‌طور روزانه و با توجه به اثرات جانبی شدید این دارو در مرگ‌ومیر حیوانات، پروتکل تمرینی فقط به مدت 4 هفته بر گروه‌های تمرینی اعمال شد. در جهت اطمینان از حاصل شدن دستاوردهای تمرین استقامتی، میزان بیان سیترات سنتاز که خود یک بیومارکر در ارزیابی ظرفیت تنفسی است، ارزیابی شد.

تمرین اعمال‌شده در تحقیق حاضر (27 متر بر دقیقه)، شدتی معادل با 75 درصد حداکثر اکسیژن مصرفی بود که در خلال چنین تمرینی انرژی مصرفی عضله اسکلتی به بیشتر از 5 برابر حالت استراحت افزایش می‌یابد [23]. تمرین ورزشی منجر به افزایش بیان PDK4 می‌شود که نقش مهمی را در انتخاب و مصرف سوبسترا بازی می‌کند [24]. به دنبال افزایش نیاز انرژی در عضله اسکلتی، سازگاری‌هایی در جهت مرتفع کردن این نیاز صورت می‌گیرد. افزایش 2 برابری در بیان سیترات سنتاز و افزایش 4 برابری در بیان PDK4 در تحقیق حاضر خود مؤید این نیاز متابولیکی اعمال‌شده بر عضله اسکلتی در گروه‌های تمرینی کنترل (سالم) است.

افزایش در بیان و محتوی PDK4 mRNA در پاسخ به تمرین نشان می‌دهد که تنظیم بیان این آنزیم، مکانیسمی کلیدی برای حفظ عملکرد PDC در عضله اسکلتی است [25]. از طرفی افزایش بیان این آنزیم در گروه‌های درمانی با دی‌کلرواستات، نشان‌دهنده این نکته مهم است که در حین تمرین استقامتی، PDK4 یک آنزیم کلیدی است که با مهار پروتئین آن مکانیسم‌های افزایش بیان آن در سطح mRNA با تمام قوای خود برای جبران این آنزیم عمل می‌کنند [25].

آنزیم دیگر در مسیر اکسیداسیون کربوهیدرات‌ها سیترات سنتاز است، لذا با توجه به نقش سیترات سنتاز در چرخه کربس و اکسیداسیون کربوهیدرات‌ها، افزایش بیان آن متعاقب تمرین استقامتی در جهت رفع نیاز انرژی صورت گرفته است. با افزایش نیاز انرژی در عضله اسکلتی متعاقب تمرین استقامتی روند تولید انرژی به سمت چربی‌ها سوق پیدا می‌کند که این امر با فعالیت و بیان هر چه بیشتر PDK4 در عضله اسکلتی همراه است که متعاقب آن مهار PDC را به همراه دارد و تولید انرژی از کربوهیدرات‌ها کاهش می‌یابد [1].

به‌عنوان‌مثال، Taivassalo و همکاران اثر دی‌کلرواستات (25 میلی‌گرم در هر کیلوگرم وزن بدن) و تمرین هوازی را روی زنان 25 ساله برای بررسی اثر درمانی این ماده مورد بررسی قرار دادند. آزمودنی‌ها به مدت 14 هفته تمرین کردند و القای دی‌کلرواستات از هفته هشتم به بعد آغاز شد. در این تحقیق، شاخص‌های ظرفیت هوازی و متابولیسم اکسیداتیو بعد از 14 هفته بهبود پیدا کرد و به دنبال آن نرخ ریکاوری ذخایر فسفوکراتین افزایش یافت و تولید لاکتات خون کاهش یافت [26]. اما در تحقیق حاضر، با مهار PDK4 بیان سیترات سنتاز به‌طور کامل مختل شد، به‌طوری‌که سطح آن به پایین‌تر از مقدار آن در گروه کنترل رسید که شاید علت این تفاوت را باید در مقدار دی‌کلرواستات تزریقی جست‌وجو کرد، زیرا در تحقیق Taivassalo و همکارانش از دوز بسیار کم 25 میلی‌گرم در هر کیلوگرم وزن بدن استفاده شده است که تأثیر مهاری زیادی روی PDK4 ندارد [26]، اما در تحقیق حاضر از دوز 150 میلی‌گرم در هر کیلوگرم وزن بدن استفاده شد که مکانیسم مهاری شدیدی روی PDK4 دارد [15].

بنابراین تزریق مقدار مناسب دی‌کلرواستات که باعث مهار کامل PDK4 می‌شود، اثرات منفی بر بیان سیترات سنتاز در عضله اسکلتی دارد. علاوه بر این، Hoshino و همکاران در تحقیقی اثر تزریق دی‌کلرواستات قبل از تمرین اینتروال با شدت زیاد را روی تجمع لاکتات و سازگاری‌های میتوکندریایی مورد بررسی قرار دادند و دریافتند که تجویز دی‌کلرواستات، تجمع لاکتات در خون و عضله را بدون ایجاد تغییر در سایر آبشارهای سیگنالینگی کاهش می‌دهد [22]، که احتمالاً علت این مغایرت با تغییر حاضر در نوع پروتکل تمرینی و مقدار دی‌کلرواستات تزریقی است. در تحقیق حاضر تمرین از نوع فعالیت استقامتی طولانی‌مدت بود، اما در تحقیق Hoshino و همکارانش از تمرین اینتروال با شدت‌های زیاد و دی کلرواستات با دوز 200 میلی‌گرم در هر کیلوگرم وزن بدن استفاده شده است [22].

در تحقیق حاضر بعد از تزریق دی‌کلرواستات به مدت 4 هفته، با توجه به سرکوب شدن آنزیم PDK4، میزان بیان PDK4 در سطح mRNA افزایش یافت که این امر پاسخی طبیعی به مهار این آنزیم کلیدی در متابولیسم انرژی هوازی است. اما نکته جالب این است که پاسخ سیترات سنتاز به مهار PDK4 همان‌طور که قبلاً به آن اشاره شد، رفتاری کاملاً متفاوت بود به‌طوری‌که بیان این فاکتور هم در گروه تمرین استقامتی+ دی‌کلرواستات و هم در گروه کنترل+ دی‌کلرواستات کاهش یافت که این اتفاق علی‌رغم افزایش 4 برابری بیان PDK4 در سطح mRNA رخ داده است. این امر احتمالاً می‌تواند نشان‌دهنده مکانیسم‌های ارتباطی متقابل بین آنزیم PDK4 با سیترات سنتاز در سطح پروتئین‌های آن‌ها باشد.

از جمله محدودیت‌های این تحقیق این بود که به خاطر نرخ مرگ‌ومیر بالا در استفاده از دی‌کلرواستات (150 میلی‌گرم در هر کیلوگرم وزن بدن)، پروتکل تمرینی فقط 4 هفته به طول انجامید. علاوه بر این، تحقیق حاضر نمی‌تواند مکانیسم کاهش سیترات سنتاز را شناسایی و معرفی کند و با توجه به اثر دی‌کلرواستات بر روی سیترات سنتاز باید به دنبال مکانیسم‌هایی که با محتوی پروتئین PDK4 فعال می‌شوند بود. بنابراین پیشنهاد می‌شود که سایر فعال‌کننده‌های PDK4 مانند PGC-1α و ERRα نیز در این مسیر مورد بررسی قرار گیرند و علاوه بر بافت عضله، بافت کبد نیز که یکی از فعال‌ترین بافت‌ها حین فعالیت ورزشی است مورد بررسی قرار گیرد.

نتیجه‌گیری

بنا بر نتایج این مطالعه، تمرین استقامتی می‌تواند منجر به بیش‌تنظیمی PDK4 و سیترات سنتاز شود و احتمالاً
آنزیم سیترات سنتاز که آنزیمی کلیدی در چرخه کربس است با آنزیم PDK4 در تعیین نوع سوبسترای مصرفی تعامل دارد.

تشکر و قدردانی

بدین‌وسیله از مرکز تحقیقات فیزیولوژی کرمان بابت حمایت مالی از این طرح و هم‌چنین پرسنل محترم این مرکز که در به انجام رسیدن این تحقیق نهایت همکاری را داشته‌اند، تشکر و قدردانی می‌کنیم.

References

[1] Zhang S, Hulver MW, McMillan RP, Cline MA, Gilbert ER. The pivotal role of pyruvate dehydrogenase kinases in metabolic flexibility. Nutr Metab 2014; 11(1): 10.

[2] Roden M. How free fatty acids inhibit glucose utilization in human skeletal muscle. News Physiol Sci 2004; 19: 92-6.

[3] Hawley JA, Leckey JJ. Carbohydrate Dependence During Prolonged, Intense Endurance Exercise. Sports Med 2015; 45(1): S5-12.

[4] Bergman BC, Butterfield GE, Wolfel EE, Casazza GA, Lopaschuk GD, Brooks GA. Evaluation of exercise and training on muscle lipid metabolism. Am J Physiol 1999; 276(1): E106-17.

[5] Holness MJ, Kraus A, Harris RA, Sugden MC. Targeted upregulation of pyruvate dehydrogenase kinase (PDK)-4 in slow-twitch skeletal muscle underlies the stable modification of the regulatory characteristics of PDK induced by high-fat feeding. Diabetes 2000; 49(5): 775-81.

[6] Gudi R, Bowker-Kinley MM, Kedishvili NY, Zhao Y, Popov KM. Diversity of the pyruvate dehydrogenase kinase gene family in humans. J Biol Chem 1995; 270(48): 28989-94.

[7] Sugden MC, Holness MJ. Interactive regulation of the pyruvate dehydrogenase complex and the carnitine palmitoyltransferase system. FASEB J 1994; 8(1): 54-61.

[8] Wang L, Sahlin K. The effect of continuous and interval exercise on PGC-1alpha and PDK4 mRNA in type I and type II fibres of human skeletal muscle. Acta Physiol 2012; 204(4): 525-32.

[9] Bowker-Kinley MM, Davis WI, Wu P, Harris RA, Popov KM. Evidence for existence of tissue-specific regulation of the mammalian pyruvate dehydrogenase complex. Biochem J 1998; 329(1): 191-6.

[10] Lundby C, Jacobs RA. Adaptations of skeletal muscle mitochondria to exercise training. Exp Physiol 2016; 101(1): 17-22.

[11] Leek BT, Mudaliar SR, Henry R, Mathieu-Costello O, Richardson RS. Effect of acute exercise on citrate synthase activity in untrained and trained human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2001; 280(2): R441-7.

[12] Rockl KS, Witczak CA, Goodyear LJ. Signaling mechanisms in skeletal muscle: acute responses and chronic adaptations to exercise. IUBMB Life 2008; 60(3): 145-53.

[13] Dohm GL, Huston RL, Askew EW, Fleshood HL. Effects of exercise, training, and diet on muscle citric acid cycle enzyme activity. Can J Biochem 1973; 51(6): 849-54.

[14] Wang L, Mascher H, Psilander N, Blomstrand E, Sahlin K. Resistance exercise enhances the molecular signaling of mitochondrial biogenesis induced by endurance exercise in human skeletal muscle. J Appl Physiol 2011; 111(5): 1335-44.

[15] Patel MS, Korotchkina LG. Regulation of mammalian pyruvate dehydrogenase complex by phosphorylation: complexity of multiple phosphorylation sites and kinases. Exp Mol Med 2001; 33(4): 191-7.

[16] Mansouri M, Nikooie R, Keshtkar A, Larijani B, Omidfar K. Effect of endurance training on retinol-binding protein 4 gene expression and its protein level in adipose tissue and the liver in diabetic rats induced by a high-fat diet and streptozotocin. J Diabetes Investig 2014; 5(5): 484-91.

[17] Lanvin O, Bianco S, Kersual N, Chalbos D, Vanacker JM. Potentiation of ICI182,780 (Fulvestrant)-induced estrogen receptor-alpha degradation by the estrogen receptor-related receptor-alpha inverse agonist XCT790. J Biol Chem 2007; 282(39): 28328-34.

[18] Li YH, Wu QS, Huang X, Liu SH, Zhang HN, Zhang Z, et al. Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering. Front Plant Sci 2016; 7:10.

[19] Constantin-Teodosiu D. Regulation of muscle pyruvate dehydrogenase complex in insulin resistance: effects of exercise and dichloroacetate. Diabetes Metab J 2013; 37(5): 301-14.

[20] Mallinson JE, Constantin-Teodosiu D, Glaves PD, Martin EA, Davies WJ, Westwood FR, et al. Pharmacological activation of the pyruvate dehydrogenase complex reduces statin-mediated upregulation of FOXO gene targets and protects against statin myopathy in rodents. J Physiol 2012; 590(24): 6389-402.

[21] Timmons JA, Gustafsson T, Sundberg CJ, Jansson E, Greenhaff PL. Muscle acetyl group availability is a major determinant of oxygen deficit in humans during submaximal exercise. Am J Physiol 1998; 274(1): 377-80.

[22] Hoshino D, Tamura Y, Masuda H, Matsunaga Y, Hatta H. Effects of decreased lactate accumulation after dichloroacetate administration on exercise training-induced mitochondrial adaptations in mouse skeletal muscle. Physiol Rep 2015; 3(9): 254-9.

[23] Hoydal MA, Wisloff U, Kemi OJ, Ellingsen O. Running speed and maximal oxygen uptake in rats and mice: practical implications for exercise training. Eur J Cardiovasc Prev Rehabil 2007; 14(6): 753-60.

[24] Wende AR, Huss JM, Schaeffer PJ, Giguere V, Kelly DP. PGC-1alpha coactivates PDK4 gene expression via the orphan nuclear receptor ERRalpha: a mechanism for transcriptional control of muscle glucose metabolism. Mol Cell Biol 2005; 25(24): 10684-94.

[25] Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin B, et al. Influence of pre-exercise muscle glycogen content on exercise-induced transcriptional regulation of metabolic genes. J Physiol 2002; 541(1): 261-71.

[26] Taivassalo T, Matthews PM, De Stefano N, Sripathi N, Genge A, Karpati G, et al. Combined aerobic training and dichloroacetate improve exercise capacity and indices of aerobic metabolism in muscle cytochrome oxidase deficiency. Neurology 1996; 47(2): 529-34.


 

The Role of Pyruvate Dehydrogenase Kinase 4 (PDK4) on the Expression of

Citrate Synthase in the Skeletal Muscle After 4 Weeks of Endurance

 Training in Male Wistar Rats

S. Aminizadeh[7],[8], A. Habibi[9], H. Marefati2,[10],[11], S. Shakerian[12]

Received: 04/03/2017      Sent for Revision: 03/05/2017  Received Revised Manuscript: 16/05/2017     Accepted: 24/05/2017

Background and Objective: Maintaining a balance between energy demand and supply is critical for health. In this process, pyruvate dehydrogenase kinase 4 (PDK4) enzyme plays an important role to maintain energy homeostasis. So, the aim of the present study was to investigate the role of PDK4 on the expression of citrate synthase in the skeletal muscle after 4 weeks of endurance training in male Wistar rats.

Materials and Methods: In this experimental study, 32 male Wistar rats were randomly divided into 4 groups including Control (n=8), Control+Dichloroacetate (n=8), Endurance training (n=8), and Endurance training+Dichloroacetate (n=8). PDK4 was inhibited by intraperitoneal injection of Dichloroacetate (DCA) (150 mg/kg.day) on daily bases. Four weeks of endurance training (5 times per week) started at 15 m/min for 20 min and reached 27 m/min for 50 min. Expression of genes was measured by Real-Time PCR method. One-way analysis of variance followed by Tukey test were used for comparisons between groups.

Results: The expression of PDK4 (P=0.001) and citrate synthase (P=0.025) mRNA in endurance training group was higher than the control group. The expression of PDK4 mRNA in the endurance training+DCA group was higher compared to the control group (P=0.001), but the expression of citrate synthase mRNA in endurance training+DCA group was lower compared to the control group (P=0.016).

Conclusion: PDK4 enzyme changes the energy source from glucose to fat, probably it is a key enzyme in the regulation of glucose oxidation in Krebs cycle and glucose oxidation.

Key words: Metabolic flexibility, Endurance training, Pyruvate dehydrogenase kinase 4, Rat

Funding: This study was funded by Shahid Chamran University of Ahvaz, and Research Center of Basic Physiology and Clinical Cardiovascular Research Institute, Kerman University of Medical Sciences.

Conflict of interest: None declared.

Ethical approval: The Ethics Committee of Research Center of Basic Physiology and Clinical Cardiovascular Research Institute, Kerman University of Medical Sciences approved the study (Ethical code: IR.KMU.REC.1394.449).

How to cite this article: Aminizadeh S, Habibi A, Marefati H, Shakerian S. The Role of Pyruvate Dehydrogenase Kinase 4 (PDK4) on the Expression of Citrate Synthase in the Skeletal Muscle After 4 Weeks of Endurance Training in Male Wistar Rats J Rafsanjan Univ Med Sci 2017; 16(3): 191-202. [Farsi]

 

[1]- دانشجوی دکتری فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه شهید چمران اهواز، اهواز، ایران

[2]- عضو مرکز تحقیقات فیزیولوژی، پژوهشکده علوم فیزیولوژی پایه و بالینی، دانشگاه علوم پزشکی کرمان، کرمان، ایران

[3]- استاد گروه آموزشی فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه شهید چمران اهواز، اهواز، ایران

[4]- دانشیار گروه آموزشی فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه شهید باهنر کرمان، کرمان، ایران

    تلفن: 32131948-034، دورنگار: 32132661-034، پست الکترونیکی: haamidmaarefati@gmail.com

[5]- دانشیار گروه آموزشی فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه بجنورد، بجنورد، ایران

[6]- استادیار گروه آموزشی فیزیولوژی ورزشی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه شهید چمران اهواز، اهواز، ایران

[7]- PhD Student of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Shahid Chamran University of Ahvaz, Ahvaz, Iran

[8]- Member of Physiology Research Center, Institute of Basic and Clinical Physiology Sciences, Kerman University of Medical Sciences, Kerman, Iran

[9]- Prof., Dept. of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Shahid Chamran University of Ahvaz, Ahvaz, Iran

[10]- Associate Prof., Dept. of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Shahid Bahonar University of Kerman, Kerman, Iran

  (Corresponding Author) Tel: (034) 32131948, Fax: (034) 32132661, haamidmaarefati@gmail.com

[11]- Associate Prof., Dept. of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Bojnourd University, Bojnourd, Iran

[12]- Assistant Prof., Dept. of Exercise Physiology, Faculty of Physical Education and Sport Sciences, Shahid Chamran University of Ahvaz, Ahvaz, Iran

نوع مطالعه: پژوهشي | موضوع مقاله: تربيت بدني
دریافت: ۱۳۹۵/۱۱/۳ | پذیرش: ۱۳۹۶/۳/۷ | انتشار: ۱۳۹۶/۳/۲۱

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb