جلد 17، شماره 7 - ( 8-1397 )                   جلد 17 شماره 7 صفحات 611-624 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Hosseini M, Fatollah Zadeh P. The Effect of High Intensity Interval Training with Vitamin E Consumption on Serum Levels of Irisin and Gene Expression of Membrane Protein FNDC5 of Soleus Muscle in Male Wistar Rats. JRUMS. 2018; 17 (7) :611-624
URL: http://journal.rums.ac.ir/article-1-4150-fa.html
حسینی معصومه، فتح الله زاده پریسا. تأثیر تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E بر سطوح سرمی‌آیریزین و بیان ژن پروتئین غشایی FNDC5عضله سولئوس در موش‌های صحرایی نر نژاد ویستار. مجله دانشگاه علوم پزشکی رفسنجان. 1397; 17 (7) :611-624

URL: http://journal.rums.ac.ir/article-1-4150-fa.html


دانشگاه آزاد تهران شرق
متن کامل [PDF 238 kb]   (36 دریافت)     |   چکیده (HTML)  (28 مشاهده)
متن کامل:   (3 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 17، مهر 1397، 624-611
 
تأثیر تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E بر سطوح سرمی‌آیریزین و بیان ژن پروتئین غشایی  FNDC5عضله سولئوس در موش‌های صحرایی نر نژاد ویستار
 
معصومه حسینی[1]، پریسا فتح‌الله‌زاده[2]
 
دریافت مقاله: 10/11/96 ارسال مقاله به نویسنده جهت اصلاح: 9/2/97      دریافت اصلاحیه از نویسنده: 26/4/97         پذیرش مقاله: 31/4/97

چکیده
زمینه و هدف: فعالیت بدنی با تأثیر بر هورمون آیریزین سبب تغییر ساختار بافت چربی سفید و تبدیل آن به چربی قهوه­ای می‌شود که می‌تواند مشکلات مربوط به چاقی را کاهش دهد. ﻫﺪف ﭘﮋوﻫﺶ حاضر تعیین تأثیر تمرین تناوبی با شدت بالا و مصرف ویتامینE  برسطوح آیریزین و بیان ژن FNDC5 (fibronectin type III domain containing 5) در موش‌های صحرایی بود.
مواد و روش­ها: در این مطالعه تجربی32 ﺳﺮ موش صحرایی نر ﻧﮋاد ویﺴﺘﺎر (200-150 گرم) به طور تصادفی به 4 گروه (ﮐﻨﺘﺮل، ﻣﮑﻤﻞ، ﺗﻤرین، ﺗﻤﺮیﻦ+ﻣﮑﻤﻞ) تقسیم شدند. برنامه تمرینی شامل هشت هفته، هفته‌ای پنج جلسه، هر جلسه 15 دقیقه شامل 5 دقیقه تمرین برای گرم کردن، 4 دقیقه تناوب شدید، 2 دقیقه تناوب بازیافت و 3 دقیقه سرد کردن بود. مقدار 100 میلی‌گرم بر کیلوگرم ویتامین E در گروه‌های مکمل به مدت 8 هفته، سه بار در هفته به صورت داخل صفاقی تجویز شد. 48ﺳﺎﻋﺖ ﭘﺲ از ﭘﺎیﺎن آﺧﺮیﻦ ﺟﻠﺴﻪ ﺗﻤﺮیﻦ، نمونه خون از حیوانات ﮔﺮﻓﺘﻪ ﺷﺪ و ﺳﻄﻮح آیریزین با روش الایزا و هم‌چنین بیان ژنFNDC5  با روش RT-PCR اﻧﺪازهﮔﯿﺮی ﺷﺪ. جهت آنالیز داده‌ها از روش آﻣﺎری ﺗﺤﻠﯿﻞ واریﺎﻧﺲ یﮏﻃﺮﻓﻪ و دوطرفه استفاده شد.
یافتهها: نتایج نشان داد 8 هفته تمرین تناوبی با شدت بالا همراه با مصرف ویتامین Eسبب افزایش معنی‌دار ﺳﻄﻮح آیریزین وFNDC5  در مقایسه با گروه کنترل می‌شود (001/.>P) .
نتیجه‌گیری: تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E احتمالاً محرک ترشح مایوکاین­هایی مانند آیریزین است که می‌تواند بافت چربی سفید را تحت تأثیر قرار دهد.
واژه‌های کلیدی: ویتامین E، آیریزین،FNDC5 ، موش صحرایی، تمرین تناوبی
 

مقدمه
بافت چربی از دو جز عملکردی متفاوت تشکیل شده است. چربی سفید که محل ذخیره انرژی است و بافت چربی قهوه‌ای که نقش گرما‌زایی (تبدیل انرژی شیمیایی به انرژی حرارتی) را ایفاء می‌کند [1]. به­نظر می‌رسد کاستن از چربی سفید و افزایش چربی قهوه‌ای، یکی از روش‌های مؤثر برای جلوگیری از بیماری‌های قلبی- عروقی و متابولیکی باشد [1]. مکانیسم مولکولی تبدیل بافت چربی سفید به قهوه‌ای و افزایش گرمازایی و در نهایت کاهش وزن اخیرأ توسط Boström و همکارانش مورد تحقیق قرار گرفته است [2]. نتایج آن‌ها نشان می‌دهد که عامل اصلی این پدیده، پپتیدی به نام آیریزین (Irisin) است که از بافت عضلانی ترشح می‌شود. آیریزین هورمون تحریک شده با فعالیت ورزشی است که تبدیل بافت چربی سفید به بافت چربی شبه قهوه‌ای را تحریک می‌کند [2]. این مایوکاین به عنوان یک مکانیسم احتمالی جدید برای کاهش وزن ناشی از تمرینات ورزشی مورد توجه پژوهش­گران قرار گرفته است. آیریزین حاصل تجزیه پروتئین غشایی وپراکسی زومی (fibronectin type III domain containing 5; FNDC5) می‌باشد که سبب کاهش وزن، افزایش مصرف اکسیژن، بهبود همئوستاز گلوکز و حساسیت به انسولین می‌شود و به وسیله افزایش ذخایر انرژی، متابولیسم سیستمیک را افزایش می‌دهد [2]. مطالعات مختلف نشان داده‌اند طی فعالیت‌های ورزشی سطوح کلسیم درون سلولی، مولکول‌های تنظیم کننده انرژی (ADP، AMP، Pi) و گونه‌های فعال اکسیژن افزایش می‌یابد؛ این عوامل زمینه‌ی ترشح FNDC5 و آیریزین را فراهم می‌سازند. با رها شدن آیریزین پروتئین جدا ساز نوع 1 (Uncoupling protein 1/ UCP1) افزایش می‌یابد. UCP1 با افزایش نفوذ پذیری غشای داخلی میتوکندری به پروتون، مانع از جفت شدن پروتون‌ها شده و پتانسیل الکترو شیمیایی را کاهش داده و مانع از ساخته شدن ATP می‌شود که این عمل منجر به القاء خواص بافت چربی قهوه‌ای در بافت چربی سفید شده و گرما‌زایی را افزایش می‌دهد [3]. تغییرات آیریزین تا حدودی وابسته به نوع و شدت فعالیت ورزشی می‌باشد [4].Huh  و همکاران در سال 2014 نشان دادند که افزایش قابل توجهی در سطوح آیریزین در پاسخ به فعالیت ورزشی تناوبی با شدت بالا نسبت به فعالیت ورزشی تداومی ‌با شدت متوسط رخ می­دهد و بیان کردند که ترشح آیریزین مستقل از سطح آمادگی بدنی و سن می‌باشد [5].
از طرف دیگر، ویتامین E مهم‌ترین آنتی‌اکسیدان غیر آنزیمی‌ محلول در چربی است که مصرف آن ظرفیت آنتی‌اکسیدآنتی ‌بدن را افزایش و قابلیت اکسیداسیون LDL را کاهش می‌دهد. نتایج نشان می‌دهد که ویتامین E در پیش­گیری از تولید رادیکال‌های آزاد و در نهایت بهبود اجرای ورزشی مؤثر است. مصرف ویتامین E موجب مهار تولید گونه‌های اکسیژنی فعال و رادیکال‌های پروکسیل لیپیدی می‌شود و از پراکسیداسیون اسید چرب غیر اشباع و فسفولیپیدهای غشاء، آسیب اکسایش لیپوپروتئین‌های کم چگالی، پروتئین‌های سلولی DNA و تخریب غشاء جلوگیری می‌کند [6]. از آن­جایی که در تحقیقی یافت نشد که به بررسی تأثیر مصرف ویتامین E بر آیریزین و FNDC5 بپردازد و نظر به این که هورمون آیریزین به تازگی کشف شده و تمرینات ورزشی از عوامل اثر‌گذار بر ترشح آیریزین هستند و نظریه نسبتاً جدید تغییر فنوتیپ بافت چربی از چربی سفید به قهوه‌ای و اثر آن بر کاهش وزن، لذا هدف این مطالعه تعیین تأثیر تمرین تناوبی با شدت بالا همراه با مصرف ویتامینE بر سطوح سرمی ‌آیریزین و بیان ژن پروتئین غشایی FNDC5 عضله سولئوس در موش‌های صحرایی نر نژاد ویستار بود.
مواد وروش‌ها
روش پژوهش حاضر از نوع تجربی با طرح پس آزمون با گروه کنترل بود که در داﻧﺸﮑﺪه ﻋﻠﻮم اﻧﺴﺎﻧﯽ داﻧﺸﮕﺎه آزاد ﺳﺎری در بهار سال 96 انجام شد. به این منظور 32 سر موش صحرایی نر نژاد ویستار با دامنه وزنی 200-150 گرم از مرکز پژوهش و تکثیر حیوانات آزمایشگاهی واحد ساری خریداری و پس از انتقال به محیط آزمایشگاه و آشنایی با محیط جدید‌، به طور تصادفی در 4 گروه کنترل‌، مکمل ویتامین E‌، تمرین (HIIT)‌، تمرین (HIIT)+مکمل ویتامین‌ E تقسیم شدند (8n=). حیوانات مورد آزمایش در طی مراحل پژوهش در قفس‌هایی از جنس پلی کربنات شفاف به ابعاد 15*15*30 سانتی‌متر ساخت شرکت رازی راد، چرخه روشنایی به تاریکی 12:12 با دمای محیطی 2±22 درجه سانتی‌گراد و رطوبت هوای 5±50 درصد و هم‌چنین با تهویه مناسب و با دسترسی آزاد به آب و غذای ویژه حیوانات آزمایشگاهی نگهداری شدند. ‌ﮐﻠﯿﻪ ﻣﺮاﺣﻞ ﺗﺤﻘﯿﻖ ﻓﻮق ﺑﺎ ﻣﺠﻮز ﺷﻤﺎره 139427ﻣﻮرد ﺗأیﯿـﺪ ﮐﻤﯿﺘﻪ اﺧﻼق داﻧﺸﮕﺎه آزاد اﺳﻼﻣﯽ واﺣﺪ ﺳﺎری ﻗﺮار ﮔﺮﻓﺖ. مقدار 100 میلی­گرم بر کیلوگرم ویتامین E (تولید شرکت ایران هورمون- ایران‌) در گروه‌‌های مکمل و تمرین+مکمل به مدت 8 هفته و سه بار در هفته به صورت داخل صفاقی تجویز شد [7].
پروتکل تمرینی
توان هوازی موش‌های صحرایی به طور غیر مستقیم ارزیابی شد. ابتدا 10 دقیقه گرم کردن با شدت 40 تا 50 درصد حداکثر اکسیژن مصرفی (VO2max) صورت گرفت. بعد از گرم شدن، آزمون با دویدن موش‌ها با سرعت 15 متر در دقیقه به مدت دو دقیقه شروع شد. سپس سرعت نوار گردان هر دو دقیقه یک بار به میزان 8/1 تا 2 متر بر دقیقه  افزایش یافت تا حیوانات دیگر قادر به دویدن نباشند. ملاک رسیدن به VO2max، عدم افزایش VO2 با وجود افزایش سرعت بود [8]. برنامه تمرینی (اجرای پروتکل ورزشی بر روی نوار گردان با شیب صفر) شامل هشت هفته، هفته‌ای پنج جلسه، هر جلسه 15 دقیقه شامل‌ 5 دقیقه گرم کردن با شدت 50 درصد ‌VO2max، 4 دقیقه تناوب شدید با شدت 95 تا 100 درصد VO2max، 2 دقیقه تناوب بازیافت با شدت 65 تا 75 درصد VO2max و3 دقیقه سرد کردن حیوانات با شدت 50 درصد VO2max بود [9].
 
برای بررسی متغیرهای بیوشیمیایی، عمل خون­گیری 48 ساعت بعد از آخرین جلسه تمرینی (برای از بین بردن اثرات حاد تمرینی و با توجه به نیمۀ عمر بیان ژن‌ها برای بررسی سازگاری) پس از 12 تا 14 ساعت ناشتایی، انجام شد. ابتدا حیوانات در فضای ویژه نمونه‌برداری (محیط استریل) توسط متخصصین کارآزموده، با ترکیبی از کتامین (30 تا 50 میلی‌گرم به ازای هر کیلوگرم وزن بدن) و زایلازین (3 تا 5 میلی‌گرم به ازای هر کیلوگرم وزن بدن) بیهوش شدند. سپس خون­گیری از بطن چپ به میزان 5 سی‌سی انجام گرفت و بلافاصله در درون لوله‌های آزمایش حاوی ماده ضد انعقاد DETA ریخته شده و در دمای20- درجه سانتی‌گراد نگهداری شد. پس از خون­گیری، بافت عضلانی سولئوس (نعلی) از طریق شکاف بر روی ناحیه پشتی جانبی اندام تحتانی جدا و پس از وزن کردن در نیتروژن مایع قرار گرفت، سپس به فریزر با دمای80 درجه سآنتی‌گراد منتقل شد. به منظور سنجش آیریزین پلاسما، ازکیت‌های اختصاصی با بر چسب (EASTBIOPHARM) ساخت کشور آمریکا با حساسیت 23 درصد میکرو‌گرم بر میلی‌لیتر و دقت (CV<%10) با روش الایزا استفاده شد.
بیان ژن FNDC5 بافت عضله سولئوس: به منظور استخراج mRNA، مقدار 50 میلی‌گرم بافت منجمد با روش هموژنیزه کردن مورد استفاده قرار گرفت. جهت جداسازی mRNA از کیت RNA-plus شرکت سیناژن طبق دستور‌العمل شرکت سازنده استفاده گردید. محلول RNA استخراج شده، با استفاده از کیت RNaseDnaseI شرکت فرمنتاس آلمان از هر گونه آلودگی به DNA و آنزیم‌های تخریب کننده RNA پاک سازی شد.‌ از نمونه، دو میکرو‌گرم mRNA برای سنتز اولین رشته cDNA به کار گرفته شد. به منظور سنتز ‌cDNA از کیت سنتز cDNA شرکت فرمنتاس استفاده گردید. مراحل PCR شامل: واسرشت اولیه (Denaturation) ‌در دمای 94 درجه سانتی‌گراد به مدت سه دقیقه، 35 سیکل که به ترتیب شامل: واسرشت در دمای 94 درجه سانتی‌گراد به مدت 30 ثانیه، اتصال  Annealingدر دمای مناسب برای هر پرایمر (60 درجه سانتی‌گراد) به مدت 30 ثانیه و طویل سازی (Elongation) در دمای 72 درجه سانتی‌گراد به مدت 45 ثانیه بود و نیز طویل‌سازی نهایی در دمای 72 درجه سانتی‌گراد به مدت پنج دقیقه بود.
برنامه Real Time PCR1 شامل: واسرشت اولیه در دمای 95 درجه سانتی‌گراد به مدت 10 دقیقه و 45 سیکل که شامل: واسرشت در دمای 95 درجه سانتی‌گراد به مدت پنج ثانیه، اتصال پرایمرها در دمای مناسب 57 درجه سانتی‌گراد به مدت 20 ثانیه، بسط در دمای 72 درجه سانتی‌گراد به مدت 15 ثانیه، تنظیم دمای ذوب در بازه 55 تا 99 درجۀ سانتی‌گراد جهت تشکیل نمودار منحنی ذوب بود. پس از پایان واکنش و تعیین خط آستانه سیکل آستانه (Ct) هر نمونه مشخص شد. از نسبت سیکل آستانه ژن مورد نظر با ژن خانه گردان، میزان بیان نسبی ژن FNDC5 با استفاده از روش ∆∆ Ct -2 به طریق زیر به دست آمد. به این صورت که ابتدا سیکل آستانه ژن مورد نظر هر نمونه را از سیکل آستانه ژن خانه گردان همان نمونه کم شد.
(∆Ct= Ct Target-Ct Housekeeping)
در مرحله بعد، ∆Ct هر نمونه را از نمونه‌ای که نسبت به آن نیاز بود مقایسه شود کم کرده، منفی عدد به دست آمده را به توان دو رسانده و بیان نسبی ژن FNDC5 را به دست می‌آوریم.
(∆∆Ct=∆Ct Target-∆Ct Reference)
-∆∆Ct
E= 2
جدول1 پرایمرهای طراحی شده را ارائه می‌کند.
 
 
جدول 1- پرایمرهای طراحی شده :F)پرایمر رفت، :R پرایمر برگشت)
Tm شرکت توالی پرایمر   نام پرایمر
63 5 -GTCTCCCACCACCATCTT-3 FNDC5       F
63 5-TCTGTCTCTGAGTGTAGCCTTAGC-3                    R
54 5 GGAGAAGATTTGGCACCACAC 3 β actin         F
56 5 GGATGGCTACGTACATGGCTG 3                    R
 
 
بعد از تجزیه و تحلیل آزمایشگاهی نمونه‌های بافتی، توصیف کمی‌ داده‌ها با استفاده از شاخص‌های مرکزی و پراکندگی از قبیل میانگین و انحراف استاندارد انجام شد و جهت تعیین نرمال بودن توزیع داده‌ها از آزمون Kolmogorov Smirnoff و بررسی تجانس واریانس‌ها از آزمون Levine استفاده شد. هم‌چنین برای بررسی تغییرات معنی‌داری هریک از متغیرهای تحقیق، بین گروه‌های مختلف، از روش آنالیز واریانس یک طرفه و در صورت مشاهده تفاوت معنی‌دار آماری از آزمون تعقیبی Tukey جهت تعیین اختلاف بین گروهی استفاده شد. هم‌چنین از روش تحلیل واریانس عاملی استفاده شد. سطح معنا‌داری برای تمام محاسبات 05/0≥P در نظر گرفته شد. کلیه عملیات آماری با استفاده از نرم‌افزار SPSS نسخه 20 انجام‌ گردید.
نتایج
در جدول 2 تغییرات وزن موش‌های چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل آورده شده است. در شــروع پــژوهش تفــاوت معنــاداری بــین وزن حیوانــات در گروه‌های کنترل و تجربی وجود نداشت. پس از 8 هفته وزن حیوانات در گـروه‌های چهارگانه افزایش یافت، اما در مقایسه بین گروهی معنـادار نبـود (05/0<p).
جدول 2- میانگین وزن موش‌های چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل
گروه وزن موش‌ها در پیش آزمون (gr) وزن موش‌ها در پس آزمون (gr)
  انحراف استاندارد ± میانگین  
کنترل 24/3 ± 65/182 93/2 ± 56/258
تمرین 82/1 ± 25/182 03/1 ± 73/264
مکمل 51/2 ± 26/183 18/3 ± 01/266
تمرین+ مکمل 32/4 ± 08/183 38/2 ± 4/260
نتایج ﺑﺎ اﺳﺘﻔﺎده از آنالیز واریانس یک طرفه نشان داد طی 8 هفته تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E سطوح سرمی‌آیریزین در گروه‌های تجربی افزایش یافت که در مقایسه با گروه کنترل معنادار بود (001/0P<). هم‌چنین سطوح FNDC5 در آزمودنی‌های گروه‌های تجربی افزایش یافت که  این افزایش در گروه تمرین+مکمل در مقایسه با گروه کنترل معنادار بود (001/0P<). با استفاده از روش همبستگی پیرسون، بین سطوح آیریزین وFNDC5  همبستگی مثبت و معناداری مشاهده شد (001/0P<).
جدول 3 شاخص‌ آماری آیریزین و FNDC5 چهار گروه کنترل، مکمل، تمرین و تمرین+مکمل را ارائه می‌کند.
 
 
 
 
 
 
جدول 3- شاخص‌های آماری آیریزین و FNDC5 چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل
گروه تجربی تعداد میانگین و انحراف معیار
آیریزین
(میکروگرم بر میلی‌لیتر)
میانگین و انحراف معیار
FNDC5))relative expression of FNDC5
کنترل 8 286/0 ±  03/1 0 ± 1
تمرین 8 494/0 ± 30/2 683/0 ± 73/1
مکمل 8 35/0 ± 80/1 808/0 ± 31/1
تمرین+مکمل 8 467/0 ± 05/3 903/0 ± 03/2
 
 
در نمودار 1 میانگین آیریزین چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل با یکدیگر مقایسه شدهاند.

نمودار 1- مقایسه میانگین آیریزین چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل
ﺑﺎ اﺳﺘﻔﺎده از آنالیز واریانس یک طرفه و آزمون تعقیبی Tukey                                                                             ﺳﻄﺢ معنی‌داری 05/0≥P                            *: معنی­دار در مقایسه با گروه کنترل
 
در نمودار 2 میانگین بیان ژنFNDC5 چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل با یکدیگر مقایسه شده اند.
جدول 4 نتایج حاصل از تحلیل واریانس عاملی را نشان می‌دهد.
 
 

نمودار 2- مقایسه میانگین بیان ژن FNDC5 چهار گروه کنترل، مکمل، تمرین، تمرین+مکمل
ﺑﺎ اﺳﺘﻔﺎده از آنالیز واریانس یک طرفه و آزمون تعقیبی Tukey
ﺳﻄﺢ معنی‌داری05/0≥P                                                                                                                                              *: معنی­دار در مقایسه با گروه کنترل
 
 
جدول 4 - نتایج حاصل از تحلیل واریانس عاملی
مقدار P F میانگین مربعات درجه آزادی مجوع مربعات شاخص متغیر
001/0> 85/10 97/34 11 97/34 عرض از مبدا آیریزین
047/0 11/6 9/15 1 9/15 تمرین
025/0 45/3 41/10 1 77/12 مکمل
001/0 64/8 81/19 1 53/21 تمرین+مکمل
        37/19 خطا
001/0> 06/13 52/36 11 52/36 عرض از مبدا FNDC5
083/0 84/3 01/14 1 01/14 تمرین
061/0 70/1 96/6 1 73/8 مکمل
001/0 35/11 01/29 1 35/32 تمرین+مکمل
        67/23 خطا
 
 
نتایج تحلیل واریانس جدول 5 نشان داد با توجه به میزان F  و نیز معنی‌داری بدست آمده (05/0≥P) اثر اصلی عامل‌های تمرین و مکمل و نیز اثر متقابل تمرین+مکمل بر شاخص آیریزین معنی‌دار بود بنابراین فرضیه آماری مبنی بر وجود تفاوت معنی‌دار مورد تأیید قرار گرفت. و اما در رابطه با شاخص FNDC5 تنها اثر متقابل تمرین+مکمل تفاوت معنی‌داری را نشان داد (05/0≥P) و اثر عامل تمرین و عامل مکمل معنی‌دار گزارش نشد (05/0≤P). بنابراین فرضیه آماری مبنی بر وجود تفاوت معنی‌دار تنها در اثر متقابل تمرین+مکمل مورد تأیید قرار گرفت.
بحث
شواهد زیادی وجود دارد که نشان می‌دهد تمرینات تناوبی می‌تواند ترکیب بدن را از طریق کاهش چربی بدن بهبود بخشد. امروزه ارزش بالقوه تمرین تناوبی در زمینۀ توسعۀ سلامت و آمادگی درک شده است. سازگاری‌های متابولیک با این شیوه فعالیت ورزشی از طریق مسیر مشابه سلولی، مشابه با سازگاری به تمرینات تداومی‌است [4]. نتایج نشان می‌دهد ویتامین E در پیشگیری از تولید رادیکال‌های آزاد و در نهایت بهبود اجرای ورزشی مؤثر است. ویتامین E درلایه چربی دیواره سلول و داخل سلول قرار می‌گیردو از پراکسیداسیون اسید چرب غیر اشباع و فسفولیپیدهای غشاء، آسیب اکسایش لیپوپروتئین‌های کم چگالی، پروتئین‌های سلولی DNA و تخریب غشاء جلوگیری می‌کند [6]. از آن­جایی­که بیشتر فرآیندهای متابولیکی بدن که باعث رشد سلول‌های ماهیچه‌ای می‌شوند به سلامت غشای سلولی وابسته هستند، این ویتامین اهمیت به­سزایی دارد. نتایج پژوهش حاضر نشان داد هشت هفته تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E سطوح سرمی ‌آیریزین موش‌های صحرایی را افزایش معناداری داد.Hazrati Molaee  و همکاران گزارش کردند 10 هفته تمرین تناوبی شدید منجر به افزایش معنادار آیریزین سرم در موش‌های صحرایی گردید [10]. Boström و همکاران نشان دادند که پس از 10 هفته تمرین استقامتی با شدت 65 درصد اکسیژن مصرفی بیشینه مقادیر آیریزین در گردش خون موش‌های صحرایی افزایش می‌یابد [2]  Reisi و همکاران گزارش کردند یک دوره تمرین حاد مقاومتی منجر به افزایش معنی­دار آیریزین پلاسما در موش‌های صحرایی نر شد [11]. این نتایج  با نتایج مطالعه حاضر همسو هستند. برخلاف عمل ذخیره سازی بافت چربی سفید، بافت چربی قهوه­ای به دلیل بیان پروتئین جفت نشده ـ1 و افزایش حجم میتوکندریایی، نقش گرمازایی را ایفاء می‌کند [12]. یکی از مطالعاتی که اخیراً انجام گردیده است، شناسایی مایوکاین جدیدی است که توسطα Peroxisome proliferator-activated receptor gamma coactivator 1-alpha1 PGC  تحریک می‌شود. α-1PGC  یک عامل فعال کننده فاکتور رونویس PPAR-γperoxisome proliferator-activated receptorγ است که بسیاری از اثرات بیولوژیکی خود را بر متابولیسم انرژی اعمال می‌کند. در اثر تمرین، این فاکتور، بیان شده و موجب تحریک بسیاری از فرآیند‌هایی مانند بیوژنز میتوکندریایی، آنژیوژنز و جلوگیری از آتروفی عضلانی می‌شود [3]. اثرات مفید ناشی از افزایش بیان α-1PGC  ممکن است خارج از بافت عضلانی نیز باشد؛ زیرا این فاکتور موجب بیان UCP1 و گرمازایی در بافت چربی قهوه‌ای می‌گردد .α-1PGC  موجب تحریک ترشح موادی از عضلۀ اسکلتی می‌گردد که بر عملکرد سایر بافت‌ها تأثیرگذار است. یکی از مهم­ترین این مواد،FNDC5  است. این پروتئین پس از شکستن در خون ترشح می‌شود که هورمون آیریزین نام گذاری شده است. سپس، آیریزین در بافت چربی قهوه‌ای موجب بیان ژن UCP1 می‌شود [13].  Boströmو همکاران نشان دادند موش‌های ترانس­ژنیکی که α 1PGC  عضلانی آنها افزایش یافته بود در مقابل چاقی مرتبط با افزایش سن و دیابت مقاومت نشان دادند. در مرحله بعد، بافت چربی این گروه از موش‌ها به منظور بررسی ژن‌های وابسته به ترموژنز و تغییرات بافت چربی قهوه‌ای بررسی شد و ملاحظه گردید که بافت چربی سفید زیر جلدی که مستعد تبدیل شدن به بافت چربی قهوه‌ای است به طور معناداری با افزایش بیان UCP1 همراه بوده است [2]. احتمالاً باید دلایل افزایش آیریزین در اثر تمرین تناوبی شدید را در سیگنال‌های فعال کننده α-1PGC  جست­و جو کرد؛ بنابراین عواملی که می‌تواند موجب فعال سازی α-1PGC  گردند، احتمالاً باعث آبشار سیگنالینگ تغییر فنوتیپ بافت چربی می‌شوند. چنان­چه شدت تمرین به اندازه‌ای نباشد که باعث تحریک بیان FNDC5 عضلانی شود، افزایشی در سطوح آیریزین در گردش خون دیده نمی‌شود [11]. از این رو، به نظر می‌رسد 8 جلسه تمرین HIIT با شدت 95 تا 100 درصد VO2max می‌تواند تلفیق مناسبی از شدت و مدت تمرین در موش‌ها باشد. با این حال برخی مطالعات نشان داده‌اند که 20 هفته تمرین استقامتی و 12 هفته ترکیب تمرین استقامتی و قدرتی اثری بر سطوح آیریزین سرم ندارد [15-14]. به­نظر می‌رسد افزایش آیریزین سرم ناشی از تأثیر مصرف ویتامین E نیز باشد. علاوه بر این، Chiang نشان داد مصرف ملاتونین باعث افزایش معنادار آیریزین سرم می‌شود [16]. Birjandi در پژوهشی نشان داد تمرین تناوبی شدید و مصرف مکمل ال-آرژنین سطوح سرمی‌آیریزین را افزایش معناداری می‌دهد [17]. در مقابل، Cavalier و همکاران نشان دادند مصرف ویتامین D بر آیریزین سرم تأثیر معناداری ندارد [18]. از دلایل تناقض در نتایج مطالعات انجام شده می‌تواند نوع فعالیت ورزشی، شدت تمرین، زمان خون‌گیری و نوع آزمودنی‌ها‌، استفاده از آنتی‌اکسیدان‌های مختلف‌، استفاده از آنتی‌بادی‌های مختلف در روش الایزا‌، مقادیر توده عضلانی، مقادیر چربی قهوه‌ای، تفاوت در مدت زمان ذخیره‌سازی نمونه‌های سرم‌، روش‌های متفاوت اندازه‌گیری و هم­چنین، تولید آیریزین از سایر اندام‌ها (نه فقط عضله) باشد.
نتیجه دیگر پژوهش نشان داد هشت هفته تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E بیان ژن FNDC5 در موش‌های صحرایی را افزایش معناداری داد. Boström و همکاران دریافتند که در آزمودنی‌های انسان، پس از 10 هفته تمرین استقامتی، بیان ژن FNDC5 به طور معنا داری افزایش می‌یابد [2]. Eaton و همکاران گزارش کردند پس از هشت هفته تمرین تناوبی شدید بیان ژن FNDC5 در مردان سالم به طور معنی‌داری افزایش می‌یابد [19]. Reisi و همکاران نیز گزارش کردند پس از هشت هفته تمرین مقاومتی بیان ژن  FNDC5 در موش‌های صحرایی نر افزایش معناداری پیدا می‌کند [11] که با نتایج پژوهش حاضر همسو هستند. در مقابل Timmons و همکاران گزارش کردند شش هفته تمرین استقامتی و تمرین قدرتی تأثیر معناداری بربیان ژن FNDC5 ندارد [14]. علت تناقض نتایج Timmons و نتایج پژوهش حاضر می‌تواند در روش انجام بررسی بیان ژن باشد؛ زیرا Timmons از روش بیان ژن MICROARRAY استفاده نمود؛ در حالی که در این پژوهش از روش RT-PCR استفاده شد. این احتمال نیز وجود دارد که افزایش بیان ژن FNDC5 ناشی از تأثیر مصرف ویتامین E باشد. نتایج دیگر پژوهش حاضر نشان داد بین سطوح آیریزین وFNDC5  در اثر هشت هفته تمرین تناوبی با شدت بالا همراه با مصرف ویتامین E هم­بستگی مثبت و معناداری وجود دارد. Atherton در پژوهشی نشان داد بین سطوح آیریزین وFNDC5  آزمودنی‌های انسان در اثر ورزش همبستگی معناداری وجود دارد [20] که با نتایج پژوهش حاضر هم­سو است.  Ellefsen و همکاران در پژوهشی گزارش کردند بین سطوح آیریزین و FNDC5 زنان غیر فعال در اثر 12 هفته تمرین قدرتی هم­بستگی معناداری وجود ندارد [21]. Pekkala و همکاران نشان دادند پس از تمرین استقامتی و ترکیب تمرین استقامتی و مقاومتی هم­بستگی معناداری بین آیریزین و FNDC5 مردان غیر ورزشکار دیده نشد [22] که با نتایج پژوهش حاضر ناهمسو هستند که ممکن است به دلیل مشخصات آزمودنی‌های تحت مطالعه (سن، جنسیت، وضعیت سلامتی، دامنه وزنی، آمادگی جسمانی)، ویژگی‌های تمرین اعمال شده (شدت و مدت) باشد. عوامل دیگری از جمله عوامل مربوط به تغذیه و تأثیر مستقیم آخرین جلسه تمرین بر نمونه‌های خونی نیز احتمالاً می‌تواند دلیل تناقض نتایج باشد.
نتیجه‌گیری
در مجموع، به نظر می‌رسد آیریزین در پاسخ به تمرین HIIT و مصرف ویتامین E در موش‌های صحرایی افزایش می‌یابد بدین صورت که تمرین، بیان ژن α-1PGC  را افزایش می‌دهد و متعاقب آن بیان ژن FNDC5 افزایش می‌یابد که در نهایت، منجر به افزایش سطوح آیریزین می‌گردد. تمرینات تناوبی شدید از طریق ترشح مایوکاین‌هایی مانند آیریزین می‌تواند سبب بهبود ترکیب بدنی از طریق افزایش تبدیل میزان چربی‌های سفید به قهوه‌ای گردد. درصورتی که تمرین به طور منظم انجام گیرد، آیریزین ممکن است در طولانی مدت بر بافت چربی سفید عمل کند و باعث افزایش بیانUCP1  شود که این امر نشان دهنده افزایش گرمازایی و هزینۀ انرژی از طریق تبدیل آن به گرما می‌باشد. ﻫﻤ­­ﭽﻨﯿﻦ، ﻣﺼﺮف ویتامین E در ﻣﺤﺪوده ﻣﻘﺎدیﺮ ﺳﻼﻣﺖ ﺑﻪ ﻫﻤﺮاه ورزش ﻣﯽﺗﻮاﻧﺪ ﺑﺮ ﺣﺼﻮل ﻧﺘﺎیﺞ ﺑﻬﺘﺮ ﺗﺄﺛﯿﺮ ﺑﮕﺬارد.
از ﺟﻤﻠﻪ ﻣﺤﺪودیﺖﻫﺎی ایﻦ ﺗﺤﻘﯿﻖ ﻓﻌﺎﻟﯿﺖ ﺷﺒﺎﻧﻪ آزﻣﻮدﻧﯽﻫﺎ ﺑﻮد (موش‌ها مانند سایر جوندگان دارای فعالیت شبانه و ریتم منظم شبانه روزی هستند و اوج فعالیت آنها در دوره تاریکی می‌باشد) ﮐﻪ ﭘﯿﺸﻨﻬﺎد ﻣﯽﺷﻮد ایﻦ ﻣﺤﺪودیﺖ در ﭘﮋوﻫﺶﻫﺎی آﺗﯽ در ﮐﻨﺘﺮل ﻣﺤﻘﻖ درآیﺪ. ﭘﯿﺸﻨﻬﺎد ﻣﯽﺷﻮد ﭘﮋوﻫﺶﻫﺎی آیﻨﺪه ﺑﺎ رویﮑﺮد ﺗﻐﯿﯿﺮ در ﻣﯿﺰان دز ویتامین E، زﻣﺎن ﻧﻤﻮﻧﻪﺑﺮداری، تجویز سایر آنتی‌اکسیدان‌ها و ﺗﻐﯿﯿﺮ ﻣﺪت و ﺷﺪت ﺗﻤﺮیﻨﺎت ورزﺷﯽ اﻧﺠﺎم ﺷﻮد.
ﺗﺸﮑﺮ و ﻗﺪرداﻧﯽ
ﻫﺰیﻨﻪ اﺟﺮای ایﻦ ﭘﮋوﻫﺶ ﺗﻮﺳﻂ داﻧﺸﺠﻮ ﺗﺄﻣﯿﻦ ﺷﺪه اﺳﺖ. ﭘﮋوﻫﺸﮕﺮان ﺑﺪیﻦوﺳﯿﻠﻪ ﻣﺮاﺗﺐ ﻗﺪرداﻧﯽ و ﺗﺸﮑﺮ ﺧﻮد را از ﻣﺴﺌﻮﻻن ﻣﺤﺘﺮم آزﻣﺎیﺸﮕﺎه ﺣﯿﻮاﻧﺎت داﻧﺸﮕﺎه آزاد واﺣﺪ ﺳﺎری ﮐﻪ در اﺟﺮای ﭘﺮوﺗﮑﻞ ﺗﺤﻘﯿﻖ ﻣﺎ را یﺎری ﮐﺮدﻧﺪ، اﻋﻼم ﻣﯽدارﻧﺪ.
 
 
 
 
References
 
 
[1] Polyzos SA, Kountouras J, Shields. K., Mantzoros CS. Irisin: a renaissance in metabolism. Metabolism 2013; 62(8): 1037-44.
[2] Boström. P, Wu J, Jedrychowski.MP, Korde A, YeL L, o JC, et al. A  PGC1- α dependent myokine that drives brown- fat- like development of white fat and thermogenesis.  Nature 2012; 481 (7382): 463-8.
[3] Seale P, Conroe HM, Estall. J, Kajimura. S, Frontini. A, Ishibashi. J, et al. Prdm16determines the thermogenic program of subcutaneous white adipose tissue in mice. The Journal of Clinical Investigation 2011; 121(1): 96-105.
]4[ Blair SN,  LaMonte  MJ., Nichaman. MZ. The evolution of physical activity recommendations: How much is enough. The American Journal of Clinical Nutrition 2004; 79(5): 913-20.
[5] Huh. JY, Mougios V, Kabasakalis A, Fatouros I, Siopi .A. Douroudos .II, et al. Exercise-induced irisin secretion is independent of age or fitness level and increased irisin may directly modulate muscle metabolism through AMPK activation. The Journal of Clinical Endocrinology & Metabolism 2014; 99(11): 2154-61.
[6] Brigelius Flohe. R, Traber M. Vitamin E: function and metabolism. Faseb J 2010; 13: 1145-55.
[7] Shokrzadeh M, Hosseini Payam S S, Zargari M, Abasi A, Abedian S, Layali I, et al . The Protective Effect of Vitamin A, C, and E on the Superoxide Dismutase Enzyme Activity in Rat Erythrocytes Exposed to Diazinon. J Mazandaran Univ Med Sci 2012; 21 (1): 30-8. [Farsi].
[8] Høydal  MA, Wisløff  U, Kemi,  OJ, Ellingsen O.  Running  speed  and  maximal  oxygen  uptake  in rats  and  mice:  practical  implications  for  exercise training. Eur J Cardiovasc Prev Rehabil 2007; 14(6): 753-60.
[9] Rahimi M , Shekarforoush Sh, Asgari A, Khoshbaten A, Bazgir.B, Taghi Mohammadi M, et al. The effect of high intensity interval training on cardioprotection against ischemia-reperfusion injury in wistar rats. EXCLI Journal 2015; 14: 237-46
[10] Hazrati Molaee S,Suri R , Ravasi AA ,Gorzi A. Effect of High Intensity Interval Training (HIIT) on Level of Irisin and Insulin Resistance Index in Rats. Journal of Physiology of Sport and Physical Activity 2015; 15: 1167-74. [Farsi]
[11] Reisi J, Rajabi H, Ghaedi K, Marandi  Z ,Asady samani  F, kazemi nasab. Effect of eight weeks’ resistance training on plasma irisin protein level and muscle FNDC5 and adipose tissue UCP1 genes expression in male rats. Sport physiology 2015; 7(28): 117-30 [Farsi]
[12] Handschin C, Spiegelman B M. The role of exercise and PGC1α in inflammation and chronic disease. Nature. 2008; 454(7203): 463-9.
[13] Wenz T, Rossi S G, Rotundo R L, Spiegelman B M, Moraes C T. Increased muscle PGC-1α expression protects from sarcopenia and metabolic disease during aging. P Natl Acad Sci USA 2009; 106(48): 20405-10.
[14] Timmons J A, Baar K, Davidsen P K, Atherton P J. Is irisin a human exercise gene.Nature 2012; 488(7413): 9-10.
[15] Norheim F, Langleite TM , Hjorth  M, Holen T, Kielland A, Stadheim HK, et al. The effects of acute and chronic exercise on PGC‐1α, irisin and browning ofsubcutaneous adipose tissue in humans. FEBS Journal 2014; 281(3): 739-49.
[16] Chiang P, Chung Cheng  L, Chih Yi.  Lin, Yi wen Chien. Effects of melatonin on lipid metabolism and circulating irisin in diet-induced obese Sprague-Dawley rats. The Faseb J 2016; 1(30): 907-13.
[17] Cheragh Birjandi S, Saghebjoo M, Hedayati M. Effect of high intensity interval training and L-Arginine supplementation on serum levels of fibroblast growth factor 21 and atrial natriuretic peptide in overweight and obese young men. J Brigand Univ Med Sci 2016; 23 (3): 211-21[Farsi].
[18] Cavalier E, Mismetti M., Souberbielle J. Evaluation of circulating irisin levels in healthy young individuals after a single 100,000 IU vitamin D dose Evaluation d’une dose unique de 100 000 UI sur les taux circulants d’irisine chez de jeunes adultes. Annales d'Endocrinologie 2014; 75(3): 162-4.
[19] Eaton M, Granata C, Barry J, Safdar A, Bishop D, Little J P. Impact of a single bout of high-intensity interval exercise and short-term interval training on interleukin-6, FNDC5, and METRNL mRNA expression in human skeletal muscle. Journal of Sport and Health Science  2017: 1-6.
[20] Atherton PJPhillips BE .Greek goddess or Greek myth: the effects of exercise on irisin/FNDC5 in humans. J Physiol 2013; 1; 591(21): 5267-8.
[21] Ellefsen S, Vikmoen O, Slettaløkken G, Whist JE , Nygaard H, Hollan HI, et al.  Irisin and FNDC5: effects of 12-week strength training, and relations to muscle phenotype and body mass composition in untrained women. European Journal of Applied Physiology 2014; 114(9): 1875- 88.
[22] Pekkala S, Wiklund PK, Hulmi JJ, Ahtiainen. JP, Horttanainen M, PöllänenE, et al. Are skeletal muscle FNDC5 gene expression and irisin release regulated by exercise and related to health. The Journal of Physiology 2013; 591 (21): 5393-400.


The Effect of High Intensity Interval Training with Vitamin E Consumption on Serum Levels of Irisin and Gene Expression of Membrane Protein FNDC5 of Soleus Muscle in Male Wistar Rats
 
M[j1] . Hosseini[3], P. Fatollah Zadeh[4]
 
Received: 30/01/2018  Sent for Revision: 29/04/2018         Received Revised Manuscript: 17/07/2018         Accepted: 22/07/2018
 
Background and Objectives: Physical activity with the effect on the irisin hormone alters the structure of the white adipose tissue and turns it into brown fat that can reduce obesity related complications. This study aimed at determining the effect of high intensity interval training) HIIT) and vitamin E consumption on levels of irisin and gene expression of FNDC5 (fibronectin type III domain containing 5) in Wistar rats.
Materials and Methods: In this experimental study, 32 male Wistar rats (150-200 grams) were randomly divided into four groups: control, supplement, training, training + supplement. Training program was planned for 8 weeks, 5 sessions per week, each session 15 minutes: 5 minutes warm up, 4 minutes intensive interval training, 2 minutes recycling, and 3 minutes cooling down. The amount of 100 mg/kg vitamin E was administered intraperitoneally in the supplement groups for 8 weeks and three times per week. Blood samples were taken 48 hours after the last training session and the levels of irisin were measured by using ELISA and FNDC5 gene expression by RT-PCR method. One-way and two-way analysis of variance were used for data analysis.
Results: The results showed that in comparison with the control group, eight weeks of HIIT with vitamin E consumption caused a significant increase in the levels of irisin and FNDC5 (p<0.001).
Conclusions: HIIT with vitamin E consumption through secretion of myokins like irisin may affect white adipose tissue.
Key words: Vitamin E, Irisin, FNDC5, Rat, Interval training
 
Funding: This study did not have any funds.
Conflict of interest: None declared.
Ethical approval: The Ethics Committee of Islamic Azad University,  East Tehran Branch approved the study (Ethics number#139427).
 
How to cite this article: Hosseini M, Fatollah Zadeh P. The Effect of High Intensity Interval Training with Vitamin E Consumption on Serum Levels of Irisin and Gene Expression of Membrane Protein FNDC5 of Soleus Muscle in Male Wistar Rats. J Rafsanjan Univ Med Sci 2018; 17 (7): 611-24. [Farsi]
 
 
 
  1. - (نویسنده مسئول) استادیارگروه فیزیولوژی ورزشی،  واحد تهران شرق، دانشگاه آزاد اسلامی، تهران، ایران
تلفن: 66429477-021، دورنگار: 66484077-021، پست الکترونیکی: mhbisadi@yahoo.com
[2]-   کارشناسی ارشد گروه تغذیه ورزشی، واحد تهران شرق، دانشگاه آزاد اسلامی، تهران، ایران  
 
[3]- Assistant Prof., Dept.of Exercise Physiology, Islamic Azad University,  East Tehran Branch, Tehran, Iran, ORCID: 0000-0001-8457-1924
  • Corresponding Author) Tel: (021) 66429477, Fax: (021) 66484077, Email: mhbisadi@yahoo.com
[4]- MSc, Dept. of Exercise Nutrition, Islamic Azad University, East Tehran Branch, Tehran, Iran, ORCID: 0000-0001-8457-1924
 

  1.  [j1]در انتهای وابستگی سازمانی هر نویسنده به زبان انگلیسی، ذکر ORCID برای هر نویسنده ضروری است.
نوع مطالعه: پژوهشي | موضوع مقاله: تربيت بدني
دریافت: ۱۳۹۶/۱۱/۸

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA code

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2018 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb