جلد 18، شماره 9 - ( 9-1398 )                   جلد 18 شماره 9 صفحات 935-950 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Vahed Z, Shahrokhabadi K. Investigation of Changes in TC1 Gene Expression Influenced by Hydro alcoholic Extract of Fennel in Thyroid Cancer Induced in Mice: An Experimental Study. JRUMS. 2019; 18 (9) :935-950
URL: http://journal.rums.ac.ir/article-1-4617-fa.html
واحد زکیه، شاهرخ آبادی خدیجه. تغییر بیان ژن TC1 تحت تأثیر عصاره هیدروالکلی گیاه رازیانه در سرطان تیروئید القاء شده در موش سوری: یک مطالعه تجربی. مجله دانشگاه علوم پزشکی رفسنجان. 1398; 18 (9) :935-950

URL: http://journal.rums.ac.ir/article-1-4617-fa.html


2- استادیار، دانشگاه آزاد اسلامی، واحد مشهد
متن کامل [PDF 703 kb]   (85 دریافت)     |   چکیده (HTML)  (205 مشاهده)
متن کامل:   (65 مشاهده)

مقاله پژوهشی

مجله دانشگاه علوم پزشکی رفسنجان

دوره 18، آذر 1398، 950-935

 

تغییر بیان ژن TC1 تحت تأثیر عصاره هیدروالکلی گیاه رازیانه در سرطان تیروئید القاء شده در موش سوری: یک مطالعه تجربی

 

زکیه واحد{C}[1]{C}، خدیجه شاهرخ آبادی{C}[2]{C}

 

 

دریافت مقاله: 23/11/97 ارسال مقاله به نویسنده جهت اصلاح: 24/1/98    دریافت اصلاحیه از نویسنده: 24/4/98         پذیرش مقاله: 25/4/98

 

چکیده

زمینه و هدف: سرطان تیروئید شایع‌ترین بدخیمی آندوکرین است که 1 درصد تمام سرطان‌ها را تشکیل می‌دهد. یکی از ژن‌های مؤثر در سرطان تیروئید ژن TC1 است. لذا هدف این تحقیق، تعیین تغییرات بیان ژن TC1 تحت تأثیر عصاره هیدروالکلی گیاه رازیانه در موش سوری بود.

مواد و روش‌ها: در این مطالعه تجربی عصاره هیدروالکلی گیاه رازیانه تهیه گردید، سپس غلظت‌های مورد نیاز برای مراحل آزمایش آماده و تست MTT بر روی سلول‌های BCPAP و L929 انجام شد. همزمان، القاء تومور در موش‌های سوری انجام گردید. از بافت تیروئید نمونه‌برداری و سپس استخراج RNA و سنتز cDNA انجام شد. بررسی نتایج تغییرات بیان ژن با تکنیک RealTime و با استفاده از آزمونهای آماری t-test و ANOVA و آنالیز Tukey صورت گرفت.

یافته‌ها: عصاره رازیانه بقاء و تکثیر سلول‌های سرطانی را کاهش داده است. کم‌ترین بقاء سلولی در غلظت 200 میکروگرم دیده شد که این کاهش معنی‌دار است (05/0>p). هم‌چنین بیان ژن TC1 در روز 28 پس از القاء سرطان افزایش معنی‌دار و پس از تیمار با عصاره کاهش معنی‌دار داشته است (05/0>p).

نتیجهگیری: طبق نتایج، بیان ژن TC1 در بدخیمیهای تیروئید افزایش نشان میدهد. بنابراین شاید بتوان از ژن TC1 به تنهایی یا به صورت ترکیب با سایر ژنها به عنوان مارکری برای تمایز بین نمونههای بدخیم و خوش‌خیم استفاده کرد. همچنین تیمار با عصاره رازیانه باعث کاهش بیان ژن و نیز کاهش و افزایش تکثیر سلولی در ردههای سلولی شده است. بنابراین شاید بتوان از عصاره رازیانه برای بهبود تکثیر سلولی و همچنین مهار سلولهای سرطانی بهره گرفت.

واژههای کلیدی: پاپیلاریکارسینوما، ژن TC1، رنگسنجی MTT، رازیانه

 

 

مقدمه

سرطان پس از بیماری‌های قلب و عروق دوّمین علت شایع مرگ میباشد. سرطان عمومأ بیماری سنین بالاست، به همین دلیل میزان بروز برخی از سرطانها در دهه چهارم تا ششم زندگی افزایش مییابد، به طوریکه با افزایش عمر، احتمال ابتلاء به سرطان نیز بیشتر می‌شود. جهش در تعداد زیادی از ژن‌ها سبب بروز سرطان است. معمولاً رخداد 3 تا 20 جهش بسته به نوع سرطان برای وقوع سرطان ضروری است و معمولاً سالها طول میکشد تا چندین جهش در یک سلول رخ دهد [1].

سرطان تیروئید شایعترین بدخیمی آندوکرین است و 1 درصد تمام سرطانها را تشکیل میدهد [2]. سرطان تیروئید نسبت به سایر سرطان‌ها در سنین پایین‌تری ظاهر می‌شود و در زنان سه برابر بیش‌تر از مردان دیده می‌شود. این سرطان در ایران هفتمین سرطان شایع در زنان و چهاردهمین در مردان و یازدهمین سرطان شایع در هر دو جنس میباشد [3]. هم‌چنین در ایران میانگین سنی بیماران 43 سال و نسبت زن به مرد 8/1 به 1 است [4]. عواملی همچون جنسیت، سن، رژیم غذایی، اشعههای رادیواکتیو، وراثت و سابقه خانوادگی در ابتلاء به سرطان تیروئید مؤثرند [6-5].

 از هر ده مورد سرطان تیروتید 8 مورد آن پاپیلاری [7] و یکی فولیکولار است که عمده به علت کمبود ید در رژیم غذایی افراد است [8]. هم‌چنین حدود سه درصد از سرطان‌های تیروئید از نوع کارسینومای آناپلاستیک و حدود چهار درصد نیز از نوع مدولاری است. این نوع اغلب به غدد لنفاوی، ریه‌ها، کبد و سایر قسمت‌ها نیز گسترش می‌یابد. این دو تیپ اخیر در تشخیص و درمان بسیار سخت هستند [10-9].

غالباً از ردههای سلولی سرطان تیروئید برای مطالعه سرطان تیروئید استفاده می‌شود. هر یک از ردههای سلولی نیز از یک نوع سرطان تیروئید خاص مشتق می‌شود. به عنوان مثال رده سلولی WRO و FTC133 از سرطان فولیکولار، BCPAP از سرطان پاپیلاری با تمایز کم، K1 و TPC1 از سرطان پاپیلاری با تمایز بالا و 8505C از سرطان آناپلاستیک مشتق شدهاند [11].

ژن تنظیم نسخه برداری TC1 یا C8orf4 (Transcription and immune response regulator) یک ژن تنظیمی مهم در مهره‌داران است که هیپرپلازی بافت چربی و تعداد آدیپوسیت‌ها را کنترل کرده و تنظیم کننده مهمی برای سلول‌های بنیادی چربی است. هیپرپلاژی بافت چربی ممکن است، در تنظیم متابولیسم دخالت داشته باشد [12]. ژن TC1 در ایجاد کارسینوم‌های مختلف و بدخیمی‌های هماتولوژی دخالت دارد. هم‌چنین بیان ژن TC1 منجر به بدخیمی در غده تیروئید می‌شود، به‌طوری‌که می‌توان از آن به عنوان نشان‌گر بدخیمی استفاده کرد [13]. مطالعات متعددی بیان‌گر بیان بالایی از ژن TC1 در بدخیمی‌های تیروئید در مقایسه با گروه‌های کنترل می‌باشد. نشان داده شده است که TC1 با chibby (cby) ارتباط برقرار کرده و رونویسی آن توسطB-catenin  به صورت آنتاگونیستی تنظیم می‌شود [14]. تنظیمTC1  توسطcby  از اهمیت بیولوژیکی قابل توجهی در مسیرWnt/B-catenin  برخوردار است، به این ترتیب که مسیر سیگنالینگ توسط کاهش سرکوب به‌وسیله cby تحریک می‌شود. در واقع ژن‌های هدف B-catenin با تنظیم بالای TC1 در رفتار تهاجمی سرطان دخالت می‌کنند. بنابراین از ژن TC1 به تنهایی یا همراه با سایر ژن‌ها می‌توان به عنوان مارکری برای تمایز بیان نمونه‌های بدخیم و خوش‌خیم، استفاده کرد [15].

 امروزه گیاهان در طب سنتی جایگاه مهمی برای حفظ سلامت عمومی، هم‌چنین برای جلوگیری، تشخیص، بهبود و درمان بیماری‌های جسمی و روحی در سراسر جهان پیدا کرده است. اعتقاد بر این است که گیاهان خواص دارویی و شفابخش دارند و مردم طی قرن‌ها از آنها استفاده می‌کرده‌اند [16]. اولین بار F.Miler در سال 1768 در نسخه هشتم کتاب فرهنگ لغت باغبان خود، رازیانه را به نام Foeni Culum Valgare معرفی کرد. این گیاه دارویی متعلق به خانواده Umbelli iferae است که تقریبا در اکثر کشورها کشت داده شده و با نام Fennel در جهان شناخته می‌شود [17]. رازیانه دارای یک ماده ضد التهابی به نام آنتول است که خواص ضد سرطانی فوق العادی دارد و به‌ویژه در پیشگیری از سرطان سینه مؤثر است. آنتیاکسیدانهای قوی موجود در تخم رازیانه نه تنها برای پیشگیری از ابتلاء به سرطان مؤثرند بلکه برای حفظ سلامت تمام اعضای بدن مفیدند. این گیاه هم‌چنین در طب سنتی در طیف گسترده‌ای از بیماری‌های دستگاه گوارش، دستگاه تولید مثل و سیستم تنفسی کاربرد دارد [18].

با توجه به اینکه هدف از انجام این پژوهش تعیین تغییرات بیان ژن TC1، بهعنوان یک ژن کلیدی و یک نشانگر بدخیمی در انواع سرطان، خصوصأ سرطان تیروئید است، بنابراین با استفاده از رده سلولی BCPAP، سرطان تیروئید در موش القاء گردید، سپس میزان تغییرات بیان ژن در بافت تیروئید نسبت به گروه کنترل و گروه تیمار با عصاره مطالعه گردید. همچنین اثر عصاره گیاه بر مورفولوژی و تکثیر سلول سرطانی و نرمال مورد بررسی قرار گرفت.

مواد و روش‌ها

این مطالعه تجربی در سال 1396 به منظور تعیین تغییرات بیان ژن در تومور القاء شده تیروئید در موش سوری، در آزمایشگاه تحقیقات ژنتیک دانشگاه آزاد اسلامی واحد مشهد انجام گردید. به این منظور دانه رازیانه به صورت تجارتی تهیه شد، همچنین گیاه رازیانه با کد هرباریومی 10011 در مرکز هرباریوم دانشگاه (IAUM) ثبت گردید.

مقدار 30 گرم از دانه رازیانه توسط آسیاب برقی (مدل نیما-ایران) آسیاب گردید. پودر تهیه شده به منظور عصاره‌گیری همراه با 300 سی سی محلول آب و الکل در داخل کاغذ مخصوص در دستگاه سوکسکله (شرکت Quickfit، انگلستان) قرار داده شد. عصارهگیری به مدت 24 ساعت انجام گردید و سپس با حذف حلال عصاره خشک شده به دست آمد، بازده عصاره محاسبه گردید و سپس در مراحل مختلف آزمایش از غلظت های مختلف عصاره جهت تیمار استفاده شد [19].

سپس سلولهای BCPAP و L929 (تهیه شده از انیستیتوپاستور ایران) در محیط کشت RPMI1640 حاوی 10 درصد سرم جنین گاوی و 1 درصد پنیسیلین-استرپتومایسین در انکوباتور CO2 (مدل UN55، شرکت Memmert- آلمان) با دمای 37 درجه و رطوبت 95 درصد، رشد داده شدند. جهت بررسی تغییرات مورفولوژی و تکثیر سلولها، تحت تیمار عصاره رازیانه، پس از کشت سلولها در 5 فلاسک مختلف، غلظتهای صفر (کنترل)، 10، 50، 100و 200 میکروگرم بر میلیلیتر از عصاره تهیه شده رازیانه به فلاسکها افزوده گردید. سپس طی 4 روز از فلاسکها با درشتنمایی 20X اینورت میکروسکوپ (مدل TE، شرکت نیکون- ژاپن) عکس تهیه و در کامپیوتر ذخیره شد. همچنین برای انجام آزمایش MTT و سنجش سیتوتوکسیسیتی، با استفاده از رنگ MTT (dimethyl thiazol tetrazolium bromide) ، در سه پلیت 96 خانهای، سلولهای BCPAP و L929 بهصورت سهتایی کشت داده شدند. 24 ساعت پس از کشت، غلظتهای 10، 20، 50، 100، 200، 400 و 800 میکروگرم بر میلیلیتر به چاهکهای سه تایی افزوده شد. یک ردیف سهتایی نیز به عنوان شاهد یا کنترل برای غلظت صفر در نظر گرفته شد. سپس بعد از 24، 48 و 72 ساعت از انجام تیمار پلیتها با 20 میکرولیتر رنگ MTT تیمار گردید. پلیتها به مدت 4 ساعت در محیط تاریک و پیچیده در فویل آلومینیومی، در انکوباتور انکوبه شده و بعد از خالی کردن رنگ به مقدار 200 میکرولیتر DMSO به چاهکها افزوده شد و بلافاصله بعد از پیپت کردن چاهکها، جذب نوری (OD) توسط دستگاه الیزاخوان (مدل StatFax، شرکت Awareness- آمریکا)، قرائت گردید [20-19].

همزمان القاء تومور در ناحیه گردن موشهای سوری انجام گردید. گروههای مورد آزمایش عبارت بودند از: 1- گروه کنترل (شاهد)، به تعداد 6 سر، که در اتاق حیوانات تحت شرایط دمایی و آب و غذای مناسب نگهداری شده و در زمانهای متفاوت همزمان با سایر نمونهها تشریح و نمونهبرداری گردید. 2- گروه توموری: جهت القاء سرطان در این گروه به تعداد 18 سر، در روز صفر به هر یک تعداد 105 سلول سرطانی در ناحیه گردن بصورت زیر پوستی تزریق گردید [21]. موشهای این گروه روزهای 14، 21 و 28 پس از تزریق سلول سرطانی تشریح شده و نمونهبرداری از بافت تیروئید صورت گرفت. 3- گروه توموری تیمار شده با عصاره رازیانه: در نمونههای این گروه به تعداد 18 سر، علاوه بر القاء تومور، پس از توموری شدن در روزهای 1 و 7 عصاره تام رازیانه با دوز 75 میلیگرم بر کیلوگرم، بر حسب وزن بدن موش، به‌صورت زیر پوستی تزریق شد، سپس نمونهبرداری در روزهای 14، 21 و 28 صورت گرفت. از تمامی گروههای مورد مطالعه نمونهبرداری از تیروئید صورت گرفت. از بافتهای تهیه شده با استفاده از کیت استخراج (شرکت دنا زیست، ایران)، استخراج RNA صورت گرفت. جهت بررسی کیفیت و کمیت RNA استخراج شده به ترتیب از ژل آگارز 5/1 درصد و دستگاه نانودراپ (مدل ایپک، BioTek- آمریکا) استفاده شد. سپس برای تمام نمونهها سنتز cDNA با استفاده از کیت پارس توس انجام شد [22].

جهت انجام واکنش Real time- PCR ابتدا پرایمرهای ژن TC1 و GAPDH با استفاده از نرم افزارoligo  نسخه 7 و اطلاعات ژن در Gene Bank طراحی گردید. سپس جهت اطمینان پرایمرها در NCBI، Blast گردید. اطلاعات پرایمرهای مورد استفاده در جدول (1) آمده است. آنگاه پرایمرها به شرکت ژن فناوران سفارش داده شد. واکنش Real time- PCR توسط دستگاه BioTek  (مدل EpachTE- آمریکا) طبق برنامه زمانی انجام گردید. نتایج با کمک نرم افزار آماری SPSS (نسخه 16) تجزیه و تحلیل گردید و از روشهای آماری تکمیلی مثل آزمونهای t و ANOVA استفاده شد. همچنین 05/0>p به عنوان سطح معنیداری در نظر گرفته شد.

 

 

جدول 1- توالی پرایمرهای مورد استفاده در آزمایش Real Time PCR

 

Amplicon Size(bp)

Sequence(5’to3’)

Gene

209 bp

F: CATCTTCTCAGCCAAGGTGC

R: TAGGGACAGCCCAAGAACAC

TC1

101 bp

F: GGAAGGTGAAGGTCGGAGTCA

R:GTCATTGATGGCAACAATATCCAC

GAPDH

 

نتایج

همان‌گونه که در بخش قبل اشاره گردید این مطالعه با هدف بررسی تغییرات بیان ژن TC1 در تومور تیروتید انجام گردید. عصاره‌گیری از رازیانه به روش سوکسله انجام شد. نتایج نشان داد که بازده عصاره تهیه شده 8/13 گرم بود.

نتایج مرفولوژی و تکثیر سلولی در شکل 1 آمده است. همانگونه که در شکل 1 دیده می‌شود عصاره رازیانه در روز اول و دوم و در غلظتهای 100 و 200 میکروگرم بر میلی‌لیتر منجر به توقف رشد و مرگ سلول‌ها گردیده است. در روزهای بعدی این نتیجه در غلظتهای 10 و 50 نیز مشاهده گردید. بنابراین میتوان نتیجه گرفت تأثیر عصاره رازیانه در بازدارندگی رشد و مرگ سلولهای سرطانی هم به زمان و هم به غلظت آن وابسته است. به این ترتیب با افزایش غلظت عصاره رازیانه و افزایش زمان تیمار، مرگ سلولها نیز افزایش یافته است. مرگ سلول‌ها به‌صورت دانه دانه یا دسته جمعی، با توجه به شکل سلولی، ایجاد غشاءهای چروکیده، دانه‌دار شدن هسته و سیتوپلاسم و مرفولوژی به هم ریخته نسبت به گروه کنترل ارزیابی گردید. لازم به ذکر است مطالعات با سه بار تکرار و عکسبرداری هر روز در ساعت مشخص و از مناطق نشانه‌گذاری شده در فلاسک‌های کشت صورت گرفته است. هم‌زمان تست MTT بر روی سلول‌ها در زمان‌های 24، 48 و 72 ساعت انجام گردید.

 
 

 

  روز

  دوز

روز اول

روز دوم

روز سوم

روز چهارم

صفر

10 میکروگرم بر میلی‌لیتر

50 میکروگرم بر میلی‌لیتر

100 میکروگرم بر میلی‌لیتر

200 میکروگرم بر میلی‌لیتر

 

شکل 1- سلول‌های BCPAP تیمار شده با عصاره رازیانه با غلظت‌های صفر، 10، 50، 100 و 200 میکروگرم بر میلی‌لیتر و مطالعه آن‌ها در روزهای اول، دوم، سوم و چهارم بعد از تیمار. تفاوت تکثیر میان نمونه کنترل نسبت به تیمارهای مختلف مشاهده می‌گردد. کاهش تعداد سلول‌ها و مرفولوژی تغییر یافته به‌خصوص در تیمارهای 100 و 200 مشاهده می‌شود. (بزرگنمایی X20 اینورت میکروسکوپ)

 

نتایج MTT بر روی رده‌های سلولی پس از 48 ساعت در شکل 2 آمده است. همانطور که در شکل مشاهده می‌شود رده سلولی L929 به عنوان رده نرمال سلولی نه تنها در برابر غلظت‌های مختلف عصاره، کاهش میزان بقاء نداشته بلکه نمونه تیمار شده نسبت به نمونه کنترل رشد بیشتری نیز داشته است که بیشترین رشد مربوط به غلظت 400 میکروگرم بر میلی‌لیتر بوده است و این افزایش رشد معنی‌دار است(05/0>p). در صورتی که رده سلولی BCPAP در اثر تیمار با عصاره کاهش تکثیر و کاهش بقای سلولی نشان داده است که این کاهش نسبت به کنترل معنی‌دار است (05/0>p). کمترین بقاء سلولهای BCPAP در غلظت 200 میکروگرم بر میلی‌لیتر بوده است. لازم به ذکر است نتایج 24 ساعت مربوط به تست MTT به دلیل معنی‌دار نبودن تغییرات آن گزارش نشده است.

 

 

شکل 2- بررسی میزان سمیت عصاره رازیانه بر روی رده سلولی L929 و BCPAP پس از 48 ساعت مقایسه میزان بقاء در نمونه‌های کنترل نسبت به تیمار. کاهش میزان بقاء در غلظت‌های 200 به بعد معنی‌دار است. (05/0>p)

 

 

نتایج MTT برای رده سلولی L929 و BCPAP پس از 72 ساعت در شکل 3 آمده است. همان‌طور که در شکل مشخص است غلظت‌های مختلف عصاره بر روی سلول‌های نرمال نه تنها اثری مبنی بر مهار یا کاهش رشد نشان نداده‌اند، بلکه به نظر می‌رسد اثر تحریکی بر رشد سلول‌ها نیز دارد. این افزایش بقاء سلولی در غلظت 200 معنی‌دار است (05/0>p). در حالی‌که عصاره بر روی رشد، بقاء و تکثیر سلول‌های سرطانی اثر مهارکنندگی نشان داده است. بیش‌ترین کاهش بقاء مربوط به غلظت 200 میکروگرم بر میلی‌لیتر است که این کاهش از نظر آماری معنی‌دار است (05/0>p).

 

شکل 3- بررسی میزان سمیت عصاره رازیانه بر روی رده سلولی L929 و BCPAP پس از 72 ساعت مقایسه میزان بقاء در نمونه‌های کنترل نسبت به تیمار. کاهش میزان بقاء در غلظت‌های 100 به بعد معنی‌دار است. (05/0>p)

 

 

هدف مهم دیگر این تحقیق بررسی میزان تغییرات بیان ژن TC1، به عنوان یکی از چندین ژن تغییر دهنده مسیر سیگنالینگ سلول‌های سرطانی بود. شکل 4 میزان تغییرات بیان ژن TC1 را در گروه‌های مورد مطالعه در موش سوری نشان می‌دهد. همان‌طور که در بخش مواد و روش‌ها نیز گفته شد به جز نمونه کنترل، در سایر نمونه‌ها ابتدا توسط سلول‌های سرطانی، بافت تیروئید مورد القاء تومور قرار گرفت و سپس در نیمی از نمونه‌ها دو مرحله تیمار با عصاره رازیانه صورت گرفت. سپس تغییرات بیان ژن در تمامی نمونه‌ها با استفاده از پرایمرهای اختصاصی ژن TC1 و با روش نرمالیز کردن با ژن هوس کیپینگ مورد بررسی قرار گرفت. همانطور که در شکل 4 دیده می‌شود ژن TC1 در روز چهاردهم پس از القاء تومور کاهش بیان داشته و در روز 21 و 28 پس از القاء تومور افزایش بیان نشان داد. در اثر تیمار با عصاره تام رازیانه در روز چهاردهم بعد از القاء تومور این ژن افزایش بیان نسبت به کنترل و نمونه T14 نشان داده است. در اثر تیمار با عصاره رازیانه در روز بیست و یکم بعد از القاء تومور در ژن TC1 نسبت به نمونهای که فقط توموری شده بود و نمونه کنترل، افزایش بیان مشاهده شد. در روز بیست و هشتم در نتیجه تیمار با عصاره رازیانه به میزان قابل توجهی از بیان این ژن کاسته شد. بنابراین با توجه به شکل 4، در میان نمونه‌های توموری روزهای 14، 21 و 28 بیش‌ترین بیان ژن مربوط به روز 28 است. افزایش معنی‌دار بیان ژن TC1، 28 روز پس از القاء تومور نشان دهنده ارتباط ژن TC1 با مراحل سرطانی شدن تیروئید است. هم‌چنین در میان نمونه‌های تیمار شده با عصاره رازیانه، کاهش بیان ژن در روز 28 نشان دهنده عملکرد مطلوب عصاره در جلوگیری از بیان ژن TC1 است. لازم به ذکر است معنی‌داری در سطح 05/0>p با استفاده از خروجی دستگاه RealTime محاسبه شده است.

 

 

 

شکل 4- نتایج بیان ژن TC1 توسط دستگاه Bio Rad. ستونها به ترتیب نمونه کنترل(con)، نمونه توموری 14 روزه (T14)، نمونه تیمار با عصاره رازیانه پس از 14 روز (T+T14)، نمونه توموری 21 روزه (T21)، نمونه تیمار با عصاره پس از 21 روز (T+T21)، نمونه توموری 28 روزه (T28)، و نمونه تیمار با عصاره پس از 28 روز (T+T28). حداکثر افزایش بیان ژن در T28 و حداقل کاهش بیان ژن در T14 دیده شده است. سطح معنی‌داری 05/0>p است.

 

 

بحث

در سالهای اخیر برای شناخت علل و عوامل مولکولی سرطان توجه به تغییرات مولکولی خصوصأ در سطح بیان ژن بیش‌تر گردیده است. به عنوان مثال نقش چندین مسیر سیگنالینگ بزرگ و اختلالات مولکولی مرتبط با آن، که در مرکز این مکانیسمها تغییرات اپیژنتیکی و ژنتیکی هستند، مورد بررسی قرار گرفته است. در این مسیرها جهش، تکرار بیش از حد ژن و متیلاسیون ژن ناهنجار گزارش شده است [23]. هدف از اجرای این تحقیق مطالعه مولکولی تغییرات بیان ژن در سرطان تیروئید بود.

یکی از مهمترین علل سرطان تیروئید جهش و تغییر میزان بیان در ژنهاست. ژن TC1 ژنی در مهرهداران است که در کارسینومهای مختلف و بدخیمیهای هماتولوژی دخالت دارد. این ژن منجر به بدخیمی در تیروئید نیز می‌شود [13].

در مطالعه ما ژن TC1 در روزهای بیست و یکم و بیست وهشتم بعد از القاء تومور افزایش بیان نشان داده است که همسو با مطالعات متعدد دیگری است که بیانگر میزان بیان بالایی از ژن TC1 در بدخیمیهای تیروئید در مقایسه با گروههای خوشخیم است [14]. با اینحال آنچه که نتایج ما نشان میدهد کاهش بیان این ژن در روز چهاردهم بعد از القاء تومور میباشد. از آنجائیکه در مسیر بیان ژنها عوامل متعددی از جمله سرکوب و یا تحریک سایر ژنها مؤثر است این نتیجه میتواند به دلایل دیگری از جمله دخالت مولکولهای دیگر رخ داده باشد. به عنوان مثال نشان داده شده است که TC1 با ژن cby ارتباط برقرار میکند که رونویسی آن توسطB-catenin  تنظیم می‌شود. تنظیم TC1 توسط ژن cby از اهمیت بیولوژیکی قابل توجهی در مسیرwnt/ B- catenin برخوردار است. در واقع ژنهای هدف B-catenin با تنظیم بالای TC1 در رفتار تهاجمی سرطان دخالت میکنند [14].

در این تحقیق برای بررسی تغییرات بیان ژن TC1 علاوه بر مطالعه نمونههای توموری، هم‌زمان تیمار با عصاره رازیانه نیز صورت گرفت. مطابق شکل 4، در حالی‌که نمونه توموری پس از 14 روز کاهش بیان نشان داده، نمونه تیمار شده با عصاره پس از 14 روز افزایش بیان نشان داده است. هم‌چنین مقایسه تغییرات دو نمونه پس از 21 روز معنی‌دار نیست. در حالی‌که 28 روز پس از القاء تومور شدت افزایش بیان ژن بسیار معنی‌دار بوده و نیز کاهش بیان ژن در تیمار با عصاره رازیانه پس از 28 روز به شدت معنی‌دار است (05/0>p).

 تحقیقات علمی موجود در مورد رازیانه نشان میدهد که رازیانه خواص دارویی مهمی دارد. به ویژه این‌که در درمان تشنج، التهاب، سرطان، یبوست، مشکلات کبدی، زخم دهان و معده استفاده می‌شود [18]. همانطور که گفته شد در روز چهاردهم بعد از القاء و تیمار، افزایش بیان مشاهده شد که این امر احتمالأ نشان دهنده آن است که عصاره رازیانه تا روز چهاردهم اثر تحریک کنندگی بر بیان ژن داشته است. اما نتایج روز 21 و 28 تاثیر عصاره رازیانه نشان دهنده اثر مطلوب عصاره بر کاهش بیان ژن TC1 است. این نتایج میتواند به این دلیل باشد که مطابق با مطالعات انجام شده قبلی، ژن TC1 در مرحله ابتدایی القاء سرطان بیان کمی دارد و با پیشرفت مراحل سرطان به سمت تهاجمی شدن، بیان این ژن نیز افزایش مییابد [24]. به نظر می‌رسد که عصاره رازیانه در مرحله ابتدایی القاء تومور، باعث تحریک و افزایش بیان ژن و در ادامه باعث کاهش بیان ژن شده است.

تاریخچه طولانی از کاربرد دارویی رازیانه وجود دارد که نشان میدهد این گیاه هیچگونه عارضه جانبی ندارد و کاملأ به عنوان یک گیاه ایمن مطرح است [18]. در پژوهشی که توسط Shah و همکارانش انجام شد، سمیت کامل رازیانه بررسی گردید. آنها دو گروه موش را مورد آزمایش قرار دادند، گروه اول به صورت حاد و گروه دوم طی 90 روز عصاره رازیانه را به‌صورت خوراکی دریافت کردند. در این آزمایش هیچگونه مرگ و میر و سمیتی از رازیانه مشاهده نشد. حتی در مقایسه با گروه کنترل موشهای نر افزایش وزن نیز یافتند [25]. نتایجی که ما از بررسی سمیت عصاره رازیانه به‌دست آوردیم همسو با نتایج Shah و همکارانش [25] بود. عصاره رازیانه نه تنها رشد رده سلولی L929 را متوقف نکرد بلکه تا حدودی هم باعث افزایش رشد این رده سلولی گردید.

در مطالعهای که  توسط Badgujar و همکارانش انجام شد، نشان داده شد که رازیانه اختلالات عفونی متعدد باکتری، قارچی، ویروسی، میکروباکتریوم و منشأ پروتوزوئیک را کنترل میکند. این گیاه خواص آنتیاکسیدانی ضد تومور، شیمی درمانی، سیتوپروتئین، هپاتوپروتئین، هیپوگلیسمی و فعالیتهای ادراری دارد. آنتیاکسیدانهای قوی موجود در تخم رازیانه نه تنها برای پیشگیری از ابتلا به سرطان مؤثر است بلکه برای حفظ سلامت تمام اعضای بدن نیز مفیدند [18]. هم‌چنین از گذشته‌های دور تاکنون دانش استفاده از گیاهان دارویی، بدلیل متابولیت‌های ثانویه و مواد زیستی، آن را به سمت استفاده از طب گیاهی سوق داده است [26]. در این تحقیق به نظر میرسد رشد رده سلولی L929 به دلیل خاصیت ضد میکروبی و حفاظت سلولی رازیانه باشد. هم‌چنین نتایجی که از تیمار رده سلولی BCPAP با عصاره رازیانه بدست آمد خاصیت ضد سرطانی رازیانه را تائید می‌کند. در این مطالعه رشد و تکثیر سلولهای BCPAP تحت تأثیر عصاره رازیانه کاهش پیدا کرد که بیشترین کاهش رشد نیز مربوط به غلظت 800 میکروگرم میشد. علاوه بر آن تغییرات ایجاد شده در مورفولوژی رده‌های سلولی نیز مورد بررسی قرار گرفت. نتایج به‌دست آمده نشان داد که با افزایش غلظت و زمانیکه سلولها در معرض عصاره رازیانه قرار گرفتهاند، مرگ سلولها نیز افزایش یافته و این توقف رشد و مرگ سلولهای سرطانی از همان ابتدای افزودن عصاره مشاهده شد.

در پژوهش دیگری محققان یک مدل محاسباتی q-pcr پایهای طراحی کردهاند که قادر است قبل از جراحی، تومورهای تیروئید خوشخیم و بدخیم را از یکدیگر تشخیص دهد. علاوه بر ژن TC1 ژن دیگر NATH، شناخته شده که در این مدل پایه سرطانزائی دخالت دارد. همچنین این گروه مدلی شامل حالت جهشی ژن BRAF نیز هست. طبق مشاهدات این گروه افزایش، کاهش یا عدم بیان ژنها عاملی برای تشخیص و مقایسه خوشخیمی یا بدخیمی تومورهاست [27].

از نتایج مطالعات گذشته و نتایج این تحقیق میتوان برداشت نمود که احتمالاً ژن TC1 در مراحل اولیه سرطان توسط ژنهای مسیر wnt/B- catenin سرکوب می‌شود ولی در مراحل پیشرفتهتر سرطان که میتواند مرحله متاستاز و تهاجمی شدن تومور باشد، افزایش مییابد. بنابراین شاید بتوان از ژن TC1 به تنهایی یا به صورت ترکیب با سایر ژنها، به عنوان مارکری برای تمایز بین نمونههای بدخیم و خوشخیم استفاده کرد و یا حتی شاید بتوان بیان بسیار بالای این ژن را نشانه تهاجمی شدن سرطان در نظر گرفت.

بنابراین پیشنهاد میگردد که از این تغییرات به عنوان مارکر بدخیمی همراه با سایر ژنها، که جهش آنها در سرطان تیروئید اثبات شده است، استفاده گردد.

نتیجهگیری

نتایج این تحقیق نشان داد که عصاره تام رازیانه بر روی
رده سلولی نرمال اثر مثبت داشته است که همسو با مطالعات گذشته بوده و تأئیدی بر خاصیت محافظت سلولی و ایمن بودن رازیانه و این
که فاقد عوارض جانبی است، می‌باشد. بر عکس در رده سلولی سرطانی عصاره رازیانه باعث کاهش رشد سلولها گردید که تأئیدی بر نقش ضد سرطانی رازیانه بود. همچنین ژن TC1 در نمونههای توموری تیمار شده با عصاره رازیانه نسبت به نمونههایی که تحت تیمار با عصاره رازیانه قرار نگرفته بودند کاهش بیان نشان دادند که این نیز نشان دهنده خاصیت ضد سرطانی عصاره تهیه شده از دانه رازیانه میباشد. لذا ضمن تأکید بر نقش این گیاه دارویی در حفظ سلامت عمومی در سلول‌های بدن، پیشنهاد می‌گردد که از این ژن همراه با مارکرهای دیگر و نیز سایر روش‌های تشخیصی برای افتراق دقیق‌تر نمونه‌های سرطانی از خوش‌خیم استفاده گردد.

تشکر و قدردانی

ضمن تشکر از تمام دوستانی که ما را در مراحل مختلف این پژوهش یاری کردند، از گروه زیست‌شناسی واحد مشهد برای تامین مکان و مواد آزمایش و هم‌چنین گروه زیست‌شناسی واحد دامغان در تصویب و تعیین مراحل علمی کمال تشکر و قدردانی را دارد.

 

 

References

 

 

[{C}1]    Gopalakr[1] Sobin LH, Gospodarowicz MK, Wittekin Ch. TNM Classification of Malignant Tumours. 7th edition, John Wiley and Sons 2009. 1-60.

[2] Chen AY, Jemal A, Ward EM. Increasing incidence of differentiated thyroid cancer in the United States: 1988-2005. Cancer 2009; 115(16): 3801-7.

[3] Larijani B, Aghakhani S, Khajedini H and Baradar-jalili R. Clinico-pathological features of thyroid cancer as observed in five referral hospitals in Iran: a review of 1177 cases. Actaoncol 2003; 42: 337-7.

[4] Khayamzadeh M, Khayamzadeh M, Tadayon N, Salmanian R, Salmanian R, Zham H, et al. Survival of thyroid cancer and social determinants in Iran, 2001-2005. Asian Pacific J cancer Prev 2011; 12(1): 95-8.

[5] Schneider TC, Abdulrahman RM, Corssmit EP, Morreau H, Smit JW, Kapiteijn E. Long- term analysis of the efficacy and tolerability of sorafenib in advanced radio-iodine refractory differentiated thyroid carcinoma: final results of a phase II trial. Eur J Endocrinol 2012; 167(5): 643-50.

[6] Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 2016; 26(1): 1-133.

[7] Smallridge RC, Copland JA, Brose MS. Efatutazone, an oral PPAR- agonist, in combination with paclitaxel in anaplastic thyroid cancer: results of a multicenter phase 1 trial. J Clin Endocrinol Metab 2013; 98(6): 2392-400.

[8] Ho AL, Grewal RK, Leboeuf R, Sherman EJ, Pfister DG, Deandris d, et al. Selumetinib-enhanced radioiodine uptake in advanced thyroid cancer. N Engl J Med 2013; 368(7): 623-32.

[9] Savvides P, Nagaiah G, Lavertu P, Fu P, Wright JJ, Chapman R, et al. Phase II trial of sorafenib in patients with advanced anaplastic carcinoma of the thyroid. Thyroid 2013; 23(5):600-4.

[10] Reynolds P, ElKin EP, Layefsky ME, Har LeeGM. Cancer in California school employees. AM J INDUST MED 1999; 36: 271-8.

[11] Saiselet M, Floor S, Tarabichi M, Dom G, Hébrant A, Staveren WCG, et al. Thyroid cancer cell lines: an overview. Frontiers in Endocrinology 2012; 133(3): 1-9.

[12] Ahmed MM, Dhanasekaran AR, Tong S, Wiseman FK, Fisher EMC, Tybulewicz VLJ, et al. Protein profiles in TC1 mice implicate novel pathway perturbations in the Down syndrome brain. Hum Mol Genet 2013; 22: 1709–24.

[13] Sunde M, McGrath KC, Young L, Matthews JM, Chua EL, Mackay JP, et al. TC-1 is a novel tumorigenic and natively disordered protein associated with thyroid cancer. Cancer Res 2004; 64(8): 2766–73.

[14] Jung Y, Bang S, Choi K, Kim E, Kim Y, Kim J, et al. TC1 (C8orf4) enhances the Wnt/beta-catenin pathway by relieving antagonistic activity of Chibby. Cancer Res 2006; 66(2): 723–8.

[15] Fu J, Lv H, Guan H, Ma X, Ji M, He N, et al. Metallothionein 1G functions as a tumor suppressor in thyroid cancer through modulating the PI3K/Akt signaling pathway. Bio Med Central Cancer 2013; 13:462.

[16] Hong L, Guo Z, Huang K, Wei S, Liu B, Meng S et al. Ethnobotanical study on medicinal plants used by Maonan people in China. Bio Med Central Cancer 2015; 11:32.

[17] Muckensturm B, Foechterlen D, Reduron JP, Danton P, Hildenbrand M. Phytochemical and chemotaxonomic studies of Foeniculum vulgare. Bio Sys and Eco 1997; 25(4):353–8.

[18] Badgujar SB, Patel VV, Bandivdekar AH. Foeniculum vulgare Mill: A review of its botany, phytochemistry, pharmacology, contemporary application, and toxicology. Biomed Res Int 2014; ID 842674.

[19] Meerloo JV, Kaspers Gertjan JL, Cloos J. Cancer Cell Culture: Methods and Protocols, 2th Edition. Springer Science 2011; Chapter 2o: 237-46.

[20] Baharara J; Nikdel N; Shahrokhabadi Kh; Amini E. The synergistic influence of Holothuria arenicola extract and imidazole carboxamide on Cellosaurus cell line B16-F10.

IR J of Fis Sci 2019; 18(1): 173-87.

[21] Navale Archana M. Animal Modeles of Cancer: A Review. Int J Pham Sci Res 2013; 4(1); 19-28.

[22] Mousaee Z, Shahrokhabadi Kh, EntezaryM. Evaluation of the effect of Fennel extract on TERT gene expression changes in mouse liver tumors induced with cancer. Feyz, J Uni of Med Sci 2018; 21(6): 543-52. [Farsi]

[23] Xing M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev Cancer 2013; 13: 184-99.

[24] Segouffin-Cariou C, Billaud M. Transforming ability of MEN2A-RET requires activation of the phosphatidylinositol 3-kinase/AKT signaling pathway. J Biol Chem 2000; 275: 3568–76.

[25] Shah AH, Qureshi S, Ageel AM. Toxicity studies in mice of ethanol extracts of Foeniculum vulgare fruit and Ruta chalepensis aerial parts. J Ethnopharmacol 1991; 34(2-3): 167–72.

[26] Al-Snafi AE. The chemical constituents and pharmacological effects of Foeniculum vulgare (A review). ISOR J Pharma 2018; 8(5): 81-96.

[27] Tomei S, Marchetti I, Zavaglia K, Lessi F, Apollo A, Aretini P, et al. A molecular computational model improves the preoperative diagnosis of thyroid nodules. BMC Cancer 2012; 12: 396.

ishnan S. A public health perspective of road traffic accidents. J Family Med Prim Care 2012; 1(2): 144-50.

[2]    Abegaz T, Gebremedhin S. Magnitude of road traffic accident related injuries and fatalities in Ethiopia. PLoS ONE 2019; 14(1): 1-10.

[3]    Rezaei S, Bagheri Lankarani K, Karami Matin B, Bazyar M, Hamzeh B, Najafi F. Determinant of Road Traffic Crash Fatalities in Iran: A Longitudinal Econometric Analysis. J Res Health Sci 2015; 15(3): 163-7.

 [4]   Hamzeh B, Najafi F, Karamimatin B, Ahmadijouybari T, Salari A, Moradinazar M. Epidemiology of traffic crash mortality in west of Iran in a 9 year period. Chin J Traumatol 2016; 19(2): 70-4.

[5]    Jafarpour S, Rahimi-Movaghar V. Determinants of risky driving behavior: a narrative review. Med J Islam Repub Iran 2014; 28(142): 1-8.

[6]    Alavi S, Mohammadi M, Soori H, Jannatifard F, Mohammadi-kalhory S. The Determination of Cognitive-Behavioral Features of Bus and Truck Drivers during Road Accidents in 2013-2014. J Saf Promot Inj Prev 2016; 3(4): 223-32. [Farsi]

[7]    Javadi SMH, Tahmasebi S, Azari Arghun T, Edrisi F, Soltani E, Hashemi Sa, et al. Investigation of the Psychosocial Factors Affecting High Risk Driving Behaviors in Adolescents in the City of Tehran, 2014. Health in Emergencies and Disasters Quarterly 2017; 3(1): 39-50. [Farsi]

[8]    Shakerinia I, Mohammadpour M. Relationship between personality traits, mental health and aggression with driving habits in high-risk drivers. Journal of Shaheed Sadoughi University of Medical Sciences 2010; 18(3): 225-33. [Farsi]

[9]    Hayley AC, Ridder Bd, Stough C, Ford TC, Downey LA. Emotional intelligence and risky driving behaviour in adults. Transp Res Part F Traffic Psychol Behav 2017; 49(1): 124-31.

[10]  Poonamallee L, Harrington AM, Nagpal M, Musial A. Improving Emotional Intelligence through Personality Development: The Effect of the Smart Phone Application based Dharma Life Program on Emotional Intelligence. Front Psychol 2018; 9(1): 169-81.

[11]  Srivastava K. Emotional intelligence and organizational effectiveness. Ind Psychiatry J 2013; 22(2): 97-9.

[12]  Mayer JD, Salovey P, Caruso DR. Emotional intelligence: new ability or eclectic traits?. Am Psychol 2008; 63(6): 503-17.

[13]  Drigas AS, Papoutsi C. A New Layered Model on Emotional Intelligence. Behav Sci (Basel) 2018; 8(5): 45-62.

[14]  Mansoori B. Standardization of the Sieber or Shiring Emotional Intelligence Questionnaire among Master's students of Tehran Universities: Allameh Tabataba'i University; 2001:1-70. [Farsi]

[15]  Oreyzi-Samani SHR, Haghayegh SA. Psychometric properties of the Manchester Driving Behavior Questionnaire. Payesh 2010; 9(1): 21-8. [Farsi]

[16]  Deng L, Yang M, Marcoulides KM. Structural Equation Modeling With Many Variables: A Systematic Review of Issues and Developments. Front Psychol 2018; 9(580): 1-14.

[17]  Mokhlesi SS, Kariman N, Ebadi A, Khoshnejad F, Dabiri F. Psychometric Properties of the Questionnaire for Urinary Incontinence Diagnosis of Married Women of Qom city in 2015. Journal of Rafsanjan University of Medical Sciences 2017; 15(10): 955-66. [Farsi]

[18]  Hooper D, Coughlan J, Mullen MR. Structural Equation Modelling: Guidelines for Determining Model Fit. EJBRM 2008; 6(1). 53-60.

[19]  Beran TN, Violato C. Structural equation modeling in medical research: a primer. BMC res notes 2010; 3(267): 1-10.

[20]  Hatami H, Fathi Ahmadsaraei N, Dowlatshahi B. Comparison between personality characters of reckless drivers and ordinary drivers (Case study: karaj). Societal Security Studies 2011; 1(26): 99-127. [Farsi]

[21]  Cramer H, Evers V, Kemper N, Wielinga B. Effects of autonomy, traffic conditions and driver personality traits on attitudes and trust towards in-vehicle agents. International Conference on Web Intelligence and Intelligent Agent Technology 2008; 3(1):477-82.

[22]  Cordellieri P, Baralla F, Ferlazzo F,Sgalla R, Piccardi L, Giannini AM. Gender Effects in Young Road Users on Road Safety Attitudes, Behaviors and Risk Perception. Front Psychol 2016; 7(1412): 1-11.

[23]  Abbaszadeh M, Alizadeh-Aghdam MB, Parizad-Benam S. Studying the effect of emotional intelligence on intentional High risky behaviors of drivers and its dimensions. Security and Social Order Strategic Studies 2017; 6(2): 1-16. [Farsi]

[24]  Souri A, Momeni E, Ahmadkhani B. Investigation And Comparison Of Emotional Intelligence Of Reckless Drivers And Ordinary Drivers In Hamedan City. Hamedan Disciplinary Sciences 2014; 2(4): 69-93. [Farsi]

[25]  Heydareh B, Aslani J, Khoramabadi Y. Coparison between emotional intelligence and personality characters of reckless drivers and ordinary drivers in kermanshah city. Traffic management studies 2016; 5(17): 153-80. [Farsi]

[26]  Asgarian FS, Aghajani M, Alavi NM. Emotional Intelligence and the Occurrence of Accidents in Motorcycle Drivers in Kashan, Iran. J Trauma Nurs 2017; 24(4): 280-6.

[27]  Babaie A, Salehi J, Elahi T. Comparison of Emotional Intelligence and Personality Characteristics of Drivers with Aberrant and Non-aberrant Behaviorsin the City of Zanjan. Advanced Psychological Research 2016; 11(42): 27-50. [Farsi]{C}


 

Investigation of Changes in TC1 Gene Expression Influenced by
Hydro alcoholic Extract of Fennel in Thyroid Cancer Induced in Mice:

An Experimental Study

 

Z. Vahed{C}[3]{C}, Kh. Shahrokhabadi{C}[4]{C}

 

 

Received: 12/02/2019  Sent for Revision: 13/04/2019 Received Revised Manuscript: 15/07/2019 Accepted:  16/07/2019

 

Background and Objectives: Thyroid cancer is the most common malignant endocrine, accounting for 1% of all cancers. One of the most effective genes in thyroid cancer is the TC1 gene. Therefore, this study aimed to determine TC1 gene expression changes under the influence of hydro alcoholic extract of fennel in mice.

Materials and Methods: In this experimental study, hydro alcoholic extract of fennel was prepared. Then, the concentrations required for the experiment were prepared and MTT assay was performed on BCPAP and L929 cells. Simultaneous tumor induction was performed in mice. Then sampling thyroid tissue, RNA extraction and cDNA Synthesis was performed. The results of gene expression changes were evaluated using Real-time technique and analyzed by t-test, ANOVA and Tukey’s test.

Results: The results showed that fennel extract reduced the survival and proliferation of cancer cells. The lowest cell survival was observed at 200 μg/ml, which was significant at the level of p<0.05. Also, TC1 gene expression increased significantly on day 28 after tumor induction and decreased significantly after treatment with extract (p<0.05).

Conclusion: According to the results, the expression of TC1 gene in thyroid malignancies increased. Therefore, it might be possible to use the TC1 gene alone or in combination with other genes as a marker for distinguishing between malignant and benign samples. Treatment with fennel extract also reduced the gene expression, and also reduced and increased cell proliferation, in the cell lines. Therefore, it may be possible to use fennel extract to improve cell proliferation and also to control cancer cells.

Key words: Papillary carcinoma, TC1 gene, MTT assay, Fennel

 

Funding: This research was sponsored by Islamic Azad University.

Conflict of interest: None declared.

Ethical approval: This study was approved by the Ethics Committee of Islamic Azad University, Damghan Branch{C}[11]{C}  (14230553961001).

 

How to cite this article: Vahed Z, Shahrokhabadi Kh. Investigation of Changes in TC1 Gene Expression Influenced by Hydro alcoholic Extract of Fennel in Thyroid Cancer Induced in Mice: An Experimental Study. J Rafsanjan Univ Med Sci 2019; 18 (9): 935-50. [Farsi]


 

مقاله پژوهشی

مجله دانشگاه علوم پزشکی رفسنجان

دوره 18، آذر 1398، 950-935

 

تغییر بیان ژن TC1 تحت تأثیر عصاره هیدروالکلی گیاه رازیانه در سرطان تیروئید القاء شده در موش سوری: یک مطالعه تجربی

 

زکیه واحد{C}[1]{C}، خدیجه شاهرخ آبادی{C}[2]{C}

 

 

دریافت مقاله: 23/11/97 ارسال مقاله به نویسنده جهت اصلاح: 24/1/98    دریافت اصلاحیه از نویسنده: 24/4/98         پذیرش مقاله: 25/4/98

 

چکیده

زمینه و هدف: سرطان تیروئید شایع‌ترین بدخیمی آندوکرین است که 1 درصد تمام سرطان‌ها را تشکیل می‌دهد. یکی از ژن‌های مؤثر در سرطان تیروئید ژن TC1 است. لذا هدف این تحقیق، تعیین تغییرات بیان ژن TC1 تحت تأثیر عصاره هیدروالکلی گیاه رازیانه در موش سوری بود.

مواد و روش‌ها: در این مطالعه تجربی عصاره هیدروالکلی گیاه رازیانه تهیه گردید، سپس غلظت‌های مورد نیاز برای مراحل آزمایش آماده و تست MTT بر روی سلول‌های BCPAP و L929 انجام شد. همزمان، القاء تومور در موش‌های سوری انجام گردید. از بافت تیروئید نمونه‌برداری و سپس استخراج RNA و سنتز cDNA انجام شد. بررسی نتایج تغییرات بیان ژن با تکنیک RealTime و با استفاده از آزمونهای آماری t-test و ANOVA و آنالیز Tukey صورت گرفت.

یافته‌ها: عصاره رازیانه بقاء و تکثیر سلول‌های سرطانی را کاهش داده است. کم‌ترین بقاء سلولی در غلظت 200 میکروگرم دیده شد که این کاهش معنی‌دار است (05/0>p). هم‌چنین بیان ژن TC1 در روز 28 پس از القاء سرطان افزایش معنی‌دار و پس از تیمار با عصاره کاهش معنی‌دار داشته است (05/0>p).

نتیجهگیری: طبق نتایج، بیان ژن TC1 در بدخیمیهای تیروئید افزایش نشان میدهد. بنابراین شاید بتوان از ژن TC1 به تنهایی یا به صورت ترکیب با سایر ژنها به عنوان مارکری برای تمایز بین نمونههای بدخیم و خوش‌خیم استفاده کرد. همچنین تیمار با عصاره رازیانه باعث کاهش بیان ژن و نیز کاهش و افزایش تکثیر سلولی در ردههای سلولی شده است. بنابراین شاید بتوان از عصاره رازیانه برای بهبود تکثیر سلولی و همچنین مهار سلولهای سرطانی بهره گرفت.

واژههای کلیدی: پاپیلاریکارسینوما، ژن TC1، رنگسنجی MTT، رازیانه

 

 

مقدمه

سرطان پس از بیماری‌های قلب و عروق دوّمین علت شایع مرگ میباشد. سرطان عمومأ بیماری سنین بالاست، به همین دلیل میزان بروز برخی از سرطانها در دهه چهارم تا ششم زندگی افزایش مییابد، به طوریکه با افزایش عمر، احتمال ابتلاء به سرطان نیز بیشتر می‌شود. جهش در تعداد زیادی از ژن‌ها سبب بروز سرطان است. معمولاً رخداد 3 تا 20 جهش بسته به نوع سرطان برای وقوع سرطان ضروری است و معمولاً سالها طول میکشد تا چندین جهش در یک سلول رخ دهد [1].

سرطان تیروئید شایعترین بدخیمی آندوکرین است و 1 درصد تمام سرطانها را تشکیل میدهد [2]. سرطان تیروئید نسبت به سایر سرطان‌ها در سنین پایین‌تری ظاهر می‌شود و در زنان سه برابر بیش‌تر از مردان دیده می‌شود. این سرطان در ایران هفتمین سرطان شایع در زنان و چهاردهمین در مردان و یازدهمین سرطان شایع در هر دو جنس میباشد [3]. هم‌چنین در ایران میانگین سنی بیماران 43 سال و نسبت زن به مرد 8/1 به 1 است [4]. عواملی همچون جنسیت، سن، رژیم غذایی، اشعههای رادیواکتیو، وراثت و سابقه خانوادگی در ابتلاء به سرطان تیروئید مؤثرند [6-5].

 از هر ده مورد سرطان تیروتید 8 مورد آن پاپیلاری [7] و یکی فولیکولار است که عمده به علت کمبود ید در رژیم غذایی افراد است [8]. هم‌چنین حدود سه درصد از سرطان‌های تیروئید از نوع کارسینومای آناپلاستیک و حدود چهار درصد نیز از نوع مدولاری است. این نوع اغلب به غدد لنفاوی، ریه‌ها، کبد و سایر قسمت‌ها نیز گسترش می‌یابد. این دو تیپ اخیر در تشخیص و درمان بسیار سخت هستند [10-9].

غالباً از ردههای سلولی سرطان تیروئید برای مطالعه سرطان تیروئید استفاده می‌شود. هر یک از ردههای سلولی نیز از یک نوع سرطان تیروئید خاص مشتق می‌شود. به عنوان مثال رده سلولی WRO و FTC133 از سرطان فولیکولار، BCPAP از سرطان پاپیلاری با تمایز کم، K1 و TPC1 از سرطان پاپیلاری با تمایز بالا و 8505C از سرطان آناپلاستیک مشتق شدهاند [11].

ژن تنظیم نسخه برداری TC1 یا C8orf4 (Transcription and immune response regulator) یک ژن تنظیمی مهم در مهره‌داران است که هیپرپلازی بافت چربی و تعداد آدیپوسیت‌ها را کنترل کرده و تنظیم کننده مهمی برای سلول‌های بنیادی چربی است. هیپرپلاژی بافت چربی ممکن است، در تنظیم متابولیسم دخالت داشته باشد [12]. ژن TC1 در ایجاد کارسینوم‌های مختلف و بدخیمی‌های هماتولوژی دخالت دارد. هم‌چنین بیان ژن TC1 منجر به بدخیمی در غده تیروئید می‌شود، به‌طوری‌که می‌توان از آن به عنوان نشان‌گر بدخیمی استفاده کرد [13]. مطالعات متعددی بیان‌گر بیان بالایی از ژن TC1 در بدخیمی‌های تیروئید در مقایسه با گروه‌های کنترل می‌باشد. نشان داده شده است که TC1 با chibby (cby) ارتباط برقرار کرده و رونویسی آن توسطB-catenin  به صورت آنتاگونیستی تنظیم می‌شود [14]. تنظیمTC1  توسطcby  از اهمیت بیولوژیکی قابل توجهی در مسیرWnt/B-catenin  برخوردار است، به این ترتیب که مسیر سیگنالینگ توسط کاهش سرکوب به‌وسیله cby تحریک می‌شود. در واقع ژن‌های هدف B-catenin با تنظیم بالای TC1 در رفتار تهاجمی سرطان دخالت می‌کنند. بنابراین از ژن TC1 به تنهایی یا همراه با سایر ژن‌ها می‌توان به عنوان مارکری برای تمایز بیان نمونه‌های بدخیم و خوش‌خیم، استفاده کرد [15].

 امروزه گیاهان در طب سنتی جایگاه مهمی برای حفظ سلامت عمومی، هم‌چنین برای جلوگیری، تشخیص، بهبود و درمان بیماری‌های جسمی و روحی در سراسر جهان پیدا کرده است. اعتقاد بر این است که گیاهان خواص دارویی و شفابخش دارند و مردم طی قرن‌ها از آنها استفاده می‌کرده‌اند [16]. اولین بار F.Miler در سال 1768 در نسخه هشتم کتاب فرهنگ لغت باغبان خود، رازیانه را به نام Foeni Culum Valgare معرفی کرد. این گیاه دارویی متعلق به خانواده Umbelli iferae است که تقریبا در اکثر کشورها کشت داده شده و با نام Fennel در جهان شناخته می‌شود [17]. رازیانه دارای یک ماده ضد التهابی به نام آنتول است که خواص ضد سرطانی فوق العادی دارد و به‌ویژه در پیشگیری از سرطان سینه مؤثر است. آنتیاکسیدانهای قوی موجود در تخم رازیانه نه تنها برای پیشگیری از ابتلاء به سرطان مؤثرند بلکه برای حفظ سلامت تمام اعضای بدن مفیدند. این گیاه هم‌چنین در طب سنتی در طیف گسترده‌ای از بیماری‌های دستگاه گوارش، دستگاه تولید مثل و سیستم تنفسی کاربرد دارد [18].

با توجه به اینکه هدف از انجام این پژوهش تعیین تغییرات بیان ژن TC1، بهعنوان یک ژن کلیدی و یک نشانگر بدخیمی در انواع سرطان، خصوصأ سرطان تیروئید است، بنابراین با استفاده از رده سلولی BCPAP، سرطان تیروئید در موش القاء گردید، سپس میزان تغییرات بیان ژن در بافت تیروئید نسبت به گروه کنترل و گروه تیمار با عصاره مطالعه گردید. همچنین اثر عصاره گیاه بر مورفولوژی و تکثیر سلول سرطانی و نرمال مورد بررسی قرار گرفت.

مواد و روش‌ها

این مطالعه تجربی در سال 1396 به منظور تعیین تغییرات بیان ژن در تومور القاء شده تیروئید در موش سوری، در آزمایشگاه تحقیقات ژنتیک دانشگاه آزاد اسلامی واحد مشهد انجام گردید. به این منظور دانه رازیانه به صورت تجارتی تهیه شد، همچنین گیاه رازیانه با کد هرباریومی 10011 در مرکز هرباریوم دانشگاه (IAUM) ثبت گردید.

مقدار 30 گرم از دانه رازیانه توسط آسیاب برقی (مدل نیما-ایران) آسیاب گردید. پودر تهیه شده به منظور عصاره‌گیری همراه با 300 سی سی محلول آب و الکل در داخل کاغذ مخصوص در دستگاه سوکسکله (شرکت Quickfit، انگلستان) قرار داده شد. عصارهگیری به مدت 24 ساعت انجام گردید و سپس با حذف حلال عصاره خشک شده به دست آمد، بازده عصاره محاسبه گردید و سپس در مراحل مختلف آزمایش از غلظت های مختلف عصاره جهت تیمار استفاده شد [19].

سپس سلولهای BCPAP و L929 (تهیه شده از انیستیتوپاستور ایران) در محیط کشت RPMI1640 حاوی 10 درصد سرم جنین گاوی و 1 درصد پنیسیلین-استرپتومایسین در انکوباتور CO2 (مدل UN55، شرکت Memmert- آلمان) با دمای 37 درجه و رطوبت 95 درصد، رشد داده شدند. جهت بررسی تغییرات مورفولوژی و تکثیر سلولها، تحت تیمار عصاره رازیانه، پس از کشت سلولها در 5 فلاسک مختلف، غلظتهای صفر (کنترل)، 10، 50، 100و 200 میکروگرم بر میلیلیتر از عصاره تهیه شده رازیانه به فلاسکها افزوده گردید. سپس طی 4 روز از فلاسکها با درشتنمایی 20X اینورت میکروسکوپ (مدل TE، شرکت نیکون- ژاپن) عکس تهیه و در کامپیوتر ذخیره شد. همچنین برای انجام آزمایش MTT و سنجش سیتوتوکسیسیتی، با استفاده از رنگ MTT (dimethyl thiazol tetrazolium bromide) ، در سه پلیت 96 خانهای، سلولهای BCPAP و L929 بهصورت سهتایی کشت داده شدند. 24 ساعت پس از کشت، غلظتهای 10، 20، 50، 100، 200، 400 و 800 میکروگرم بر میلیلیتر به چاهکهای سه تایی افزوده شد. یک ردیف سهتایی نیز به عنوان شاهد یا کنترل برای غلظت صفر در نظر گرفته شد. سپس بعد از 24، 48 و 72 ساعت از انجام تیمار پلیتها با 20 میکرولیتر رنگ MTT تیمار گردید. پلیتها به مدت 4 ساعت در محیط تاریک و پیچیده در فویل آلومینیومی، در انکوباتور انکوبه شده و بعد از خالی کردن رنگ به مقدار 200 میکرولیتر DMSO به چاهکها افزوده شد و بلافاصله بعد از پیپت کردن چاهکها، جذب نوری (OD) توسط دستگاه الیزاخوان (مدل StatFax، شرکت Awareness- آمریکا)، قرائت گردید [20-19].

همزمان القاء تومور در ناحیه گردن موشهای سوری انجام گردید. گروههای مورد آزمایش عبارت بودند از: 1- گروه کنترل (شاهد)، به تعداد 6 سر، که در اتاق حیوانات تحت شرایط دمایی و آب و غذای مناسب نگهداری شده و در زمانهای متفاوت همزمان با سایر نمونهها تشریح و نمونهبرداری گردید. 2- گروه توموری: جهت القاء سرطان در این گروه به تعداد 18 سر، در روز صفر به هر یک تعداد 105 سلول سرطانی در ناحیه گردن بصورت زیر پوستی تزریق گردید [21]. موشهای این گروه روزهای 14، 21 و 28 پس از تزریق سلول سرطانی تشریح شده و نمونهبرداری از بافت تیروئید صورت گرفت. 3- گروه توموری تیمار شده با عصاره رازیانه: در نمونههای این گروه به تعداد 18 سر، علاوه بر القاء تومور، پس از توموری شدن در روزهای 1 و 7 عصاره تام رازیانه با دوز 75 میلیگرم بر کیلوگرم، بر حسب وزن بدن موش، به‌صورت زیر پوستی تزریق شد، سپس نمونهبرداری در روزهای 14، 21 و 28 صورت گرفت. از تمامی گروههای مورد مطالعه نمونهبرداری از تیروئید صورت گرفت. از بافتهای تهیه شده با استفاده از کیت استخراج (شرکت دنا زیست، ایران)، استخراج RNA صورت گرفت. جهت بررسی کیفیت و کمیت RNA استخراج شده به ترتیب از ژل آگارز 5/1 درصد و دستگاه نانودراپ (مدل ایپک، BioTek- آمریکا) استفاده شد. سپس برای تمام نمونهها سنتز cDNA با استفاده از کیت پارس توس انجام شد [22].

جهت انجام واکنش Real time- PCR ابتدا پرایمرهای ژن TC1 و GAPDH با استفاده از نرم افزارoligo  نسخه 7 و اطلاعات ژن در Gene Bank طراحی گردید. سپس جهت اطمینان پرایمرها در NCBI، Blast گردید. اطلاعات پرایمرهای مورد استفاده در جدول (1) آمده است. آنگاه پرایمرها به شرکت ژن فناوران سفارش داده شد. واکنش Real time- PCR توسط دستگاه BioTek  (مدل EpachTE- آمریکا) طبق برنامه زمانی انجام گردید. نتایج با کمک نرم افزار آماری SPSS (نسخه 16) تجزیه و تحلیل گردید و از روشهای آماری تکمیلی مثل آزمونهای t و ANOVA استفاده شد. همچنین 05/0>p به عنوان سطح معنیداری در نظر گرفته شد.

 

 

جدول 1- توالی پرایمرهای مورد استفاده در آزمایش Real Time PCR

 

Amplicon Size(bp)

Sequence(5’to3’)

Gene

209 bp

F: CATCTTCTCAGCCAAGGTGC

R: TAGGGACAGCCCAAGAACAC

TC1

101 bp

F: GGAAGGTGAAGGTCGGAGTCA

R:GTCATTGATGGCAACAATATCCAC

GAPDH

 

نتایج

همان‌گونه که در بخش قبل اشاره گردید این مطالعه با هدف بررسی تغییرات بیان ژن TC1 در تومور تیروتید انجام گردید. عصاره‌گیری از رازیانه به روش سوکسله انجام شد. نتایج نشان داد که بازده عصاره تهیه شده 8/13 گرم بود.

نتایج مرفولوژی و تکثیر سلولی در شکل 1 آمده است. همانگونه که در شکل 1 دیده می‌شود عصاره رازیانه در روز اول و دوم و در غلظتهای 100 و 200 میکروگرم بر میلی‌لیتر منجر به توقف رشد و مرگ سلول‌ها گردیده است. در روزهای بعدی این نتیجه در غلظتهای 10 و 50 نیز مشاهده گردید. بنابراین میتوان نتیجه گرفت تأثیر عصاره رازیانه در بازدارندگی رشد و مرگ سلولهای سرطانی هم به زمان و هم به غلظت آن وابسته است. به این ترتیب با افزایش غلظت عصاره رازیانه و افزایش زمان تیمار، مرگ سلولها نیز افزایش یافته است. مرگ سلول‌ها به‌صورت دانه دانه یا دسته جمعی، با توجه به شکل سلولی، ایجاد غشاءهای چروکیده، دانه‌دار شدن هسته و سیتوپلاسم و مرفولوژی به هم ریخته نسبت به گروه کنترل ارزیابی گردید. لازم به ذکر است مطالعات با سه بار تکرار و عکسبرداری هر روز در ساعت مشخص و از مناطق نشانه‌گذاری شده در فلاسک‌های کشت صورت گرفته است. هم‌زمان تست MTT بر روی سلول‌ها در زمان‌های 24، 48 و 72 ساعت انجام گردید.

 
 

 

  روز

  دوز

روز اول

روز دوم

روز سوم

روز چهارم

صفر

10 میکروگرم بر میلی‌لیتر

50 میکروگرم بر میلی‌لیتر

100 میکروگرم بر میلی‌لیتر

200 میکروگرم بر میلی‌لیتر

 

شکل 1- سلول‌های BCPAP تیمار شده با عصاره رازیانه با غلظت‌های صفر، 10، 50، 100 و 200 میکروگرم بر میلی‌لیتر و مطالعه آن‌ها در روزهای اول، دوم، سوم و چهارم بعد از تیمار. تفاوت تکثیر میان نمونه کنترل نسبت به تیمارهای مختلف مشاهده می‌گردد. کاهش تعداد سلول‌ها و مرفولوژی تغییر یافته به‌خصوص در تیمارهای 100 و 200 مشاهده می‌شود. (بزرگنمایی X20 اینورت میکروسکوپ)

 

نتایج MTT بر روی رده‌های سلولی پس از 48 ساعت در شکل 2 آمده است. همانطور که در شکل مشاهده می‌شود رده سلولی L929 به عنوان رده نرمال سلولی نه تنها در برابر غلظت‌های مختلف عصاره، کاهش میزان بقاء نداشته بلکه نمونه تیمار شده نسبت به نمونه کنترل رشد بیشتری نیز داشته است که بیشترین رشد مربوط به غلظت 400 میکروگرم بر میلی‌لیتر بوده است و این افزایش رشد معنی‌دار است(05/0>p). در صورتی که رده سلولی BCPAP در اثر تیمار با عصاره کاهش تکثیر و کاهش بقای سلولی نشان داده است که این کاهش نسبت به کنترل معنی‌دار است (05/0>p). کمترین بقاء سلولهای BCPAP در غلظت 200 میکروگرم بر میلی‌لیتر بوده است. لازم به ذکر است نتایج 24 ساعت مربوط به تست MTT به دلیل معنی‌دار نبودن تغییرات آن گزارش نشده است.

 

 

شکل 2- بررسی میزان سمیت عصاره رازیانه بر روی رده سلولی L929 و BCPAP پس از 48 ساعت مقایسه میزان بقاء در نمونه‌های کنترل نسبت به تیمار. کاهش میزان بقاء در غلظت‌های 200 به بعد معنی‌دار است. (05/0>p)

 

 

نتایج MTT برای رده سلولی L929 و BCPAP پس از 72 ساعت در شکل 3 آمده است. همان‌طور که در شکل مشخص است غلظت‌های مختلف عصاره بر روی سلول‌های نرمال نه تنها اثری مبنی بر مهار یا کاهش رشد نشان نداده‌اند، بلکه به نظر می‌رسد اثر تحریکی بر رشد سلول‌ها نیز دارد. این افزایش بقاء سلولی در غلظت 200 معنی‌دار است (05/0>p). در حالی‌که عصاره بر روی رشد، بقاء و تکثیر سلول‌های سرطانی اثر مهارکنندگی نشان داده است. بیش‌ترین کاهش بقاء مربوط به غلظت 200 میکروگرم بر میلی‌لیتر است که این کاهش از نظر آماری معنی‌دار است (05/0>p).

 

شکل 3- بررسی میزان سمیت عصاره رازیانه بر روی رده سلولی L929 و BCPAP پس از 72 ساعت مقایسه میزان بقاء در نمونه‌های کنترل نسبت به تیمار. کاهش میزان بقاء در غلظت‌های 100 به بعد معنی‌دار است. (05/0>p)

 

 

هدف مهم دیگر این تحقیق بررسی میزان تغییرات بیان ژن TC1، به عنوان یکی از چندین ژن تغییر دهنده مسیر سیگنالینگ سلول‌های سرطانی بود. شکل 4 میزان تغییرات بیان ژن TC1 را در گروه‌های مورد مطالعه در موش سوری نشان می‌دهد. همان‌طور که در بخش مواد و روش‌ها نیز گفته شد به جز نمونه کنترل، در سایر نمونه‌ها ابتدا توسط سلول‌های سرطانی، بافت تیروئید مورد القاء تومور قرار گرفت و سپس در نیمی از نمونه‌ها دو مرحله تیمار با عصاره رازیانه صورت گرفت. سپس تغییرات بیان ژن در تمامی نمونه‌ها با استفاده از پرایمرهای اختصاصی ژن TC1 و با روش نرمالیز کردن با ژن هوس کیپینگ مورد بررسی قرار گرفت. همانطور که در شکل 4 دیده می‌شود ژن TC1 در روز چهاردهم پس از القاء تومور کاهش بیان داشته و در روز 21 و 28 پس از القاء تومور افزایش بیان نشان داد. در اثر تیمار با عصاره تام رازیانه در روز چهاردهم بعد از القاء تومور این ژن افزایش بیان نسبت به کنترل و نمونه T14 نشان داده است. در اثر تیمار با عصاره رازیانه در روز بیست و یکم بعد از القاء تومور در ژن TC1 نسبت به نمونهای که فقط توموری شده بود و نمونه کنترل، افزایش بیان مشاهده شد. در روز بیست و هشتم در نتیجه تیمار با عصاره رازیانه به میزان قابل توجهی از بیان این ژن کاسته شد. بنابراین با توجه به شکل 4، در میان نمونه‌های توموری روزهای 14، 21 و 28 بیش‌ترین بیان ژن مربوط به روز 28 است. افزایش معنی‌دار بیان ژن TC1، 28 روز پس از القاء تومور نشان دهنده ارتباط ژن TC1 با مراحل سرطانی شدن تیروئید است. هم‌چنین در میان نمونه‌های تیمار شده با عصاره رازیانه، کاهش بیان ژن در روز 28 نشان دهنده عملکرد مطلوب عصاره در جلوگیری از بیان ژن TC1 است. لازم به ذکر است معنی‌داری در سطح 05/0>p با استفاده از خروجی دستگاه RealTime محاسبه شده است.

 

 

 

شکل 4- نتایج بیان ژن TC1 توسط دستگاه Bio Rad. ستونها به ترتیب نمونه کنترل(con)، نمونه توموری 14 روزه (T14)، نمونه تیمار با عصاره رازیانه پس از 14 روز (T+T14)، نمونه توموری 21 روزه (T21)، نمونه تیمار با عصاره پس از 21 روز (T+T21)، نمونه توموری 28 روزه (T28)، و نمونه تیمار با عصاره پس از 28 روز (T+T28). حداکثر افزایش بیان ژن در T28 و حداقل کاهش بیان ژن در T14 دیده شده است. سطح معنی‌داری 05/0>p است.

 

 

بحث

در سالهای اخیر برای شناخت علل و عوامل مولکولی سرطان توجه به تغییرات مولکولی خصوصأ در سطح بیان ژن بیش‌تر گردیده است. به عنوان مثال نقش چندین مسیر سیگنالینگ بزرگ و اختلالات مولکولی مرتبط با آن، که در مرکز این مکانیسمها تغییرات اپیژنتیکی و ژنتیکی هستند، مورد بررسی قرار گرفته است. در این مسیرها جهش، تکرار بیش از حد ژن و متیلاسیون ژن ناهنجار گزارش شده است [23]. هدف از اجرای این تحقیق مطالعه مولکولی تغییرات بیان ژن در سرطان تیروئید بود.

یکی از مهمترین علل سرطان تیروئید جهش و تغییر میزان بیان در ژنهاست. ژن TC1 ژنی در مهرهداران است که در کارسینومهای مختلف و بدخیمیهای هماتولوژی دخالت دارد. این ژن منجر به بدخیمی در تیروئید نیز می‌شود [13].

در مطالعه ما ژن TC1 در روزهای بیست و یکم و بیست وهشتم بعد از القاء تومور افزایش بیان نشان داده است که همسو با مطالعات متعدد دیگری است که بیانگر میزان بیان بالایی از ژن TC1 در بدخیمیهای تیروئید در مقایسه با گروههای خوشخیم است [14]. با اینحال آنچه که نتایج ما نشان میدهد کاهش بیان این ژن در روز چهاردهم بعد از القاء تومور میباشد. از آنجائیکه در مسیر بیان ژنها عوامل متعددی از جمله سرکوب و یا تحریک سایر ژنها مؤثر است این نتیجه میتواند به دلایل دیگری از جمله دخالت مولکولهای دیگر رخ داده باشد. به عنوان مثال نشان داده شده است که TC1 با ژن cby ارتباط برقرار میکند که رونویسی آن توسطB-catenin  تنظیم می‌شود. تنظیم TC1 توسط ژن cby از اهمیت بیولوژیکی قابل توجهی در مسیرwnt/ B- catenin برخوردار است. در واقع ژنهای هدف B-catenin با تنظیم بالای TC1 در رفتار تهاجمی سرطان دخالت میکنند [14].

در این تحقیق برای بررسی تغییرات بیان ژن TC1 علاوه بر مطالعه نمونههای توموری، هم‌زمان تیمار با عصاره رازیانه نیز صورت گرفت. مطابق شکل 4، در حالی‌که نمونه توموری پس از 14 روز کاهش بیان نشان داده، نمونه تیمار شده با عصاره پس از 14 روز افزایش بیان نشان داده است. هم‌چنین مقایسه تغییرات دو نمونه پس از 21 روز معنی‌دار نیست. در حالی‌که 28 روز پس از القاء تومور شدت افزایش بیان ژن بسیار معنی‌دار بوده و نیز کاهش بیان ژن در تیمار با عصاره رازیانه پس از 28 روز به شدت معنی‌دار است (05/0>p).

 تحقیقات علمی موجود در مورد رازیانه نشان میدهد که رازیانه خواص دارویی مهمی دارد. به ویژه این‌که در درمان تشنج، التهاب، سرطان، یبوست، مشکلات کبدی، زخم دهان و معده استفاده می‌شود [18]. همانطور که گفته شد در روز چهاردهم بعد از القاء و تیمار، افزایش بیان مشاهده شد که این امر احتمالأ نشان دهنده آن است که عصاره رازیانه تا روز چهاردهم اثر تحریک کنندگی بر بیان ژن داشته است. اما نتایج روز 21 و 28 تاثیر عصاره رازیانه نشان دهنده اثر مطلوب عصاره بر کاهش بیان ژن TC1 است. این نتایج میتواند به این دلیل باشد که مطابق با مطالعات انجام شده قبلی، ژن TC1 در مرحله ابتدایی القاء سرطان بیان کمی دارد و با پیشرفت مراحل سرطان به سمت تهاجمی شدن، بیان این ژن نیز افزایش مییابد [24]. به نظر می‌رسد که عصاره رازیانه در مرحله ابتدایی القاء تومور، باعث تحریک و افزایش بیان ژن و در ادامه باعث کاهش بیان ژن شده است.

تاریخچه طولانی از کاربرد دارویی رازیانه وجود دارد که نشان میدهد این گیاه هیچگونه عارضه جانبی ندارد و کاملأ به عنوان یک گیاه ایمن مطرح است [18]. در پژوهشی که توسط Shah و همکارانش انجام شد، سمیت کامل رازیانه بررسی گردید. آنها دو گروه موش را مورد آزمایش قرار دادند، گروه اول به صورت حاد و گروه دوم طی 90 روز عصاره رازیانه را به‌صورت خوراکی دریافت کردند. در این آزمایش هیچگونه مرگ و میر و سمیتی از رازیانه مشاهده نشد. حتی در مقایسه با گروه کنترل موشهای نر افزایش وزن نیز یافتند [25]. نتایجی که ما از بررسی سمیت عصاره رازیانه به‌دست آوردیم همسو با نتایج Shah و همکارانش [25] بود. عصاره رازیانه نه تنها رشد رده سلولی L929 را متوقف نکرد بلکه تا حدودی هم باعث افزایش رشد این رده سلولی گردید.

در مطالعهای که  توسط Badgujar و همکارانش انجام شد، نشان داده شد که رازیانه اختلالات عفونی متعدد باکتری، قارچی، ویروسی، میکروباکتریوم و منشأ پروتوزوئیک را کنترل میکند. این گیاه خواص آنتیاکسیدانی ضد تومور، شیمی درمانی، سیتوپروتئین، هپاتوپروتئین، هیپوگلیسمی و فعالیتهای ادراری دارد. آنتیاکسیدانهای قوی موجود در تخم رازیانه نه تنها برای پیشگیری از ابتلا به سرطان مؤثر است بلکه برای حفظ سلامت تمام اعضای بدن نیز مفیدند [18]. هم‌چنین از گذشته‌های دور تاکنون دانش استفاده از گیاهان دارویی، بدلیل متابولیت‌های ثانویه و مواد زیستی، آن را به سمت استفاده از طب گیاهی سوق داده است [26]. در این تحقیق به نظر میرسد رشد رده سلولی L929 به دلیل خاصیت ضد میکروبی و حفاظت سلولی رازیانه باشد. هم‌چنین نتایجی که از تیمار رده سلولی BCPAP با عصاره رازیانه بدست آمد خاصیت ضد سرطانی رازیانه را تائید می‌کند. در این مطالعه رشد و تکثیر سلولهای BCPAP تحت تأثیر عصاره رازیانه کاهش پیدا کرد که بیشترین کاهش رشد نیز مربوط به غلظت 800 میکروگرم میشد. علاوه بر آن تغییرات ایجاد شده در مورفولوژی رده‌های سلولی نیز مورد بررسی قرار گرفت. نتایج به‌دست آمده نشان داد که با افزایش غلظت و زمانیکه سلولها در معرض عصاره رازیانه قرار گرفتهاند، مرگ سلولها نیز افزایش یافته و این توقف رشد و مرگ سلولهای سرطانی از همان ابتدای افزودن عصاره مشاهده شد.

در پژوهش دیگری محققان یک مدل محاسباتی q-pcr پایهای طراحی کردهاند که قادر است قبل از جراحی، تومورهای تیروئید خوشخیم و بدخیم را از یکدیگر تشخیص دهد. علاوه بر ژن TC1 ژن دیگر NATH، شناخته شده که در این مدل پایه سرطانزائی دخالت دارد. همچنین این گروه مدلی شامل حالت جهشی ژن BRAF نیز هست. طبق مشاهدات این گروه افزایش، کاهش یا عدم بیان ژنها عاملی برای تشخیص و مقایسه خوشخیمی یا بدخیمی تومورهاست [27].

از نتایج مطالعات گذشته و نتایج این تحقیق میتوان برداشت نمود که احتمالاً ژن TC1 در مراحل اولیه سرطان توسط ژنهای مسیر wnt/B- catenin سرکوب می‌شود ولی در مراحل پیشرفتهتر سرطان که میتواند مرحله متاستاز و تهاجمی شدن تومور باشد، افزایش مییابد. بنابراین شاید بتوان از ژن TC1 به تنهایی یا به صورت ترکیب با سایر ژنها، به عنوان مارکری برای تمایز بین نمونههای بدخیم و خوشخیم استفاده کرد و یا حتی شاید بتوان بیان بسیار بالای این ژن را نشانه تهاجمی شدن سرطان در نظر گرفت.

بنابراین پیشنهاد میگردد که از این تغییرات به عنوان مارکر بدخیمی همراه با سایر ژنها، که جهش آنها در سرطان تیروئید اثبات شده است، استفاده گردد.

نتیجهگیری

نتایج این تحقیق نشان داد که عصاره تام رازیانه بر روی
رده سلولی نرمال اثر مثبت داشته است که همسو با مطالعات گذشته بوده و تأئیدی بر خاصیت محافظت سلولی و ایمن بودن رازیانه و این
که فاقد عوارض جانبی است، می‌باشد. بر عکس در رده سلولی سرطانی عصاره رازیانه باعث کاهش رشد سلولها گردید که تأئیدی بر نقش ضد سرطانی رازیانه بود. همچنین ژن TC1 در نمونههای توموری تیمار شده با عصاره رازیانه نسبت به نمونههایی که تحت تیمار با عصاره رازیانه قرار نگرفته بودند کاهش بیان نشان دادند که این نیز نشان دهنده خاصیت ضد سرطانی عصاره تهیه شده از دانه رازیانه میباشد. لذا ضمن تأکید بر نقش این گیاه دارویی در حفظ سلامت عمومی در سلول‌های بدن، پیشنهاد می‌گردد که از این ژن همراه با مارکرهای دیگر و نیز سایر روش‌های تشخیصی برای افتراق دقیق‌تر نمونه‌های سرطانی از خوش‌خیم استفاده گردد.

تشکر و قدردانی

ضمن تشکر از تمام دوستانی که ما را در مراحل مختلف این پژوهش یاری کردند، از گروه زیست‌شناسی واحد مشهد برای تامین مکان و مواد آزمایش و هم‌چنین گروه زیست‌شناسی واحد دامغان در تصویب و تعیین مراحل علمی کمال تشکر و قدردانی را دارد.

 

 

References

 

 

[{C}1]    Gopalakr[1] Sobin LH, Gospodarowicz MK, Wittekin Ch. TNM Classification of Malignant Tumours. 7th edition, John Wiley and Sons 2009. 1-60.

[2] Chen AY, Jemal A, Ward EM. Increasing incidence of differentiated thyroid cancer in the United States: 1988-2005. Cancer 2009; 115(16): 3801-7.

[3] Larijani B, Aghakhani S, Khajedini H and Baradar-jalili R. Clinico-pathological features of thyroid cancer as observed in five referral hospitals in Iran: a review of 1177 cases. Actaoncol 2003; 42: 337-7.

[4] Khayamzadeh M, Khayamzadeh M, Tadayon N, Salmanian R, Salmanian R, Zham H, et al. Survival of thyroid cancer and social determinants in Iran, 2001-2005. Asian Pacific J cancer Prev 2011; 12(1): 95-8.

[5] Schneider TC, Abdulrahman RM, Corssmit EP, Morreau H, Smit JW, Kapiteijn E. Long- term analysis of the efficacy and tolerability of sorafenib in advanced radio-iodine refractory differentiated thyroid carcinoma: final results of a phase II trial. Eur J Endocrinol 2012; 167(5): 643-50.

[6] Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 2016; 26(1): 1-133.

[7] Smallridge RC, Copland JA, Brose MS. Efatutazone, an oral PPAR- agonist, in combination with paclitaxel in anaplastic thyroid cancer: results of a multicenter phase 1 trial. J Clin Endocrinol Metab 2013; 98(6): 2392-400.

[8] Ho AL, Grewal RK, Leboeuf R, Sherman EJ, Pfister DG, Deandris d, et al. Selumetinib-enhanced radioiodine uptake in advanced thyroid cancer. N Engl J Med 2013; 368(7): 623-32.

[9] Savvides P, Nagaiah G, Lavertu P, Fu P, Wright JJ, Chapman R, et al. Phase II trial of sorafenib in patients with advanced anaplastic carcinoma of the thyroid. Thyroid 2013; 23(5):600-4.

[10] Reynolds P, ElKin EP, Layefsky ME, Har LeeGM. Cancer in California school employees. AM J INDUST MED 1999; 36: 271-8.

[11] Saiselet M, Floor S, Tarabichi M, Dom G, Hébrant A, Staveren WCG, et al. Thyroid cancer cell lines: an overview. Frontiers in Endocrinology 2012; 133(3): 1-9.

[12] Ahmed MM, Dhanasekaran AR, Tong S, Wiseman FK, Fisher EMC, Tybulewicz VLJ, et al. Protein profiles in TC1 mice implicate novel pathway perturbations in the Down syndrome brain. Hum Mol Genet 2013; 22: 1709–24.

[13] Sunde M, McGrath KC, Young L, Matthews JM, Chua EL, Mackay JP, et al. TC-1 is a novel tumorigenic and natively disordered protein associated with thyroid cancer. Cancer Res 2004; 64(8): 2766–73.

[14] Jung Y, Bang S, Choi K, Kim E, Kim Y, Kim J, et al. TC1 (C8orf4) enhances the Wnt/beta-catenin pathway by relieving antagonistic activity of Chibby. Cancer Res 2006; 66(2): 723–8.

[15] Fu J, Lv H, Guan H, Ma X, Ji M, He N, et al. Metallothionein 1G functions as a tumor suppressor in thyroid cancer through modulating the PI3K/Akt signaling pathway. Bio Med Central Cancer 2013; 13:462.

[16] Hong L, Guo Z, Huang K, Wei S, Liu B, Meng S et al. Ethnobotanical study on medicinal plants used by Maonan people in China. Bio Med Central Cancer 2015; 11:32.

[17] Muckensturm B, Foechterlen D, Reduron JP, Danton P, Hildenbrand M. Phytochemical and chemotaxonomic studies of Foeniculum vulgare. Bio Sys and Eco 1997; 25(4):353–8.

[18] Badgujar SB, Patel VV, Bandivdekar AH. Foeniculum vulgare Mill: A review of its botany, phytochemistry, pharmacology, contemporary application, and toxicology. Biomed Res Int 2014; ID 842674.

[19] Meerloo JV, Kaspers Gertjan JL, Cloos J. Cancer Cell Culture: Methods and Protocols, 2th Edition. Springer Science 2011; Chapter 2o: 237-46.

[20] Baharara J; Nikdel N; Shahrokhabadi Kh; Amini E. The synergistic influence of Holothuria arenicola extract and imidazole carboxamide on Cellosaurus cell line B16-F10.

IR J of Fis Sci 2019; 18(1): 173-87.

[21] Navale Archana M. Animal Modeles of Cancer: A Review. Int J Pham Sci Res 2013; 4(1); 19-28.

[22] Mousaee Z, Shahrokhabadi Kh, EntezaryM. Evaluation of the effect of Fennel extract on TERT gene expression changes in mouse liver tumors induced with cancer. Feyz, J Uni of Med Sci 2018; 21(6): 543-52. [Farsi]

[23] Xing M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev Cancer 2013; 13: 184-99.

[24] Segouffin-Cariou C, Billaud M. Transforming ability of MEN2A-RET requires activation of the phosphatidylinositol 3-kinase/AKT signaling pathway. J Biol Chem 2000; 275: 3568–76.

[25] Shah AH, Qureshi S, Ageel AM. Toxicity studies in mice of ethanol extracts of Foeniculum vulgare fruit and Ruta chalepensis aerial parts. J Ethnopharmacol 1991; 34(2-3): 167–72.

[26] Al-Snafi AE. The chemical constituents and pharmacological effects of Foeniculum vulgare (A review). ISOR J Pharma 2018; 8(5): 81-96.

[27] Tomei S, Marchetti I, Zavaglia K, Lessi F, Apollo A, Aretini P, et al. A molecular computational model improves the preoperative diagnosis of thyroid nodules. BMC Cancer 2012; 12: 396.

ishnan S. A public health perspective of road traffic accidents. J Family Med Prim Care 2012; 1(2): 144-50.

[2]    Abegaz T, Gebremedhin S. Magnitude of road traffic accident related injuries and fatalities in Ethiopia. PLoS ONE 2019; 14(1): 1-10.

[3]    Rezaei S, Bagheri Lankarani K, Karami Matin B, Bazyar M, Hamzeh B, Najafi F. Determinant of Road Traffic Crash Fatalities in Iran: A Longitudinal Econometric Analysis. J Res Health Sci 2015; 15(3): 163-7.

 [4]   Hamzeh B, Najafi F, Karamimatin B, Ahmadijouybari T, Salari A, Moradinazar M. Epidemiology of traffic crash mortality in west of Iran in a 9 year period. Chin J Traumatol 2016; 19(2): 70-4.

[5]    Jafarpour S, Rahimi-Movaghar V. Determinants of risky driving behavior: a narrative review. Med J Islam Repub Iran 2014; 28(142): 1-8.

[6]    Alavi S, Mohammadi M, Soori H, Jannatifard F, Mohammadi-kalhory S. The Determination of Cognitive-Behavioral Features of Bus and Truck Drivers during Road Accidents in 2013-2014. J Saf Promot Inj Prev 2016; 3(4): 223-32. [Farsi]

[7]    Javadi SMH, Tahmasebi S, Azari Arghun T, Edrisi F, Soltani E, Hashemi Sa, et al. Investigation of the Psychosocial Factors Affecting High Risk Driving Behaviors in Adolescents in the City of Tehran, 2014. Health in Emergencies and Disasters Quarterly 2017; 3(1): 39-50. [Farsi]

[8]    Shakerinia I, Mohammadpour M. Relationship between personality traits, mental health and aggression with driving habits in high-risk drivers. Journal of Shaheed Sadoughi University of Medical Sciences 2010; 18(3): 225-33. [Farsi]

[9]    Hayley AC, Ridder Bd, Stough C, Ford TC, Downey LA. Emotional intelligence and risky driving behaviour in adults. Transp Res Part F Traffic Psychol Behav 2017; 49(1): 124-31.

[10]  Poonamallee L, Harrington AM, Nagpal M, Musial A. Improving Emotional Intelligence through Personality Development: The Effect of the Smart Phone Application based Dharma Life Program on Emotional Intelligence. Front Psychol 2018; 9(1): 169-81.

[11]  Srivastava K. Emotional intelligence and organizational effectiveness. Ind Psychiatry J 2013; 22(2): 97-9.

[12]  Mayer JD, Salovey P, Caruso DR. Emotional intelligence: new ability or eclectic traits?. Am Psychol 2008; 63(6): 503-17.

[13]  Drigas AS, Papoutsi C. A New Layered Model on Emotional Intelligence. Behav Sci (Basel) 2018; 8(5): 45-62.

[14]  Mansoori B. Standardization of the Sieber or Shiring Emotional Intelligence Questionnaire among Master's students of Tehran Universities: Allameh Tabataba'i University; 2001:1-70. [Farsi]

[15]  Oreyzi-Samani SHR, Haghayegh SA. Psychometric properties of the Manchester Driving Behavior Questionnaire. Payesh 2010; 9(1): 21-8. [Farsi]

[16]  Deng L, Yang M, Marcoulides KM. Structural Equation Modeling With Many Variables: A Systematic Review of Issues and Developments. Front Psychol 2018; 9(580): 1-14.

[17]  Mokhlesi SS, Kariman N, Ebadi A, Khoshnejad F, Dabiri F. Psychometric Properties of the Questionnaire for Urinary Incontinence Diagnosis of Married Women of Qom city in 2015. Journal of Rafsanjan University of Medical Sciences 2017; 15(10): 955-66. [Farsi]

[18]  Hooper D, Coughlan J, Mullen MR. Structural Equation Modelling: Guidelines for Determining Model Fit. EJBRM 2008; 6(1). 53-60.

[19]  Beran TN, Violato C. Structural equation modeling in medical research: a primer. BMC res notes 2010; 3(267): 1-10.

[20]  Hatami H, Fathi Ahmadsaraei N, Dowlatshahi B. Comparison between personality characters of reckless drivers and ordinary drivers (Case study: karaj). Societal Security Studies 2011; 1(26): 99-127. [Farsi]

[21]  Cramer H, Evers V, Kemper N, Wielinga B. Effects of autonomy, traffic conditions and driver personality traits on attitudes and trust towards in-vehicle agents. International Conference on Web Intelligence and Intelligent Agent Technology 2008; 3(1):477-82.

[22]  Cordellieri P, Baralla F, Ferlazzo F,Sgalla R, Piccardi L, Giannini AM. Gender Effects in Young Road Users on Road Safety Attitudes, Behaviors and Risk Perception. Front Psychol 2016; 7(1412): 1-11.

[23]  Abbaszadeh M, Alizadeh-Aghdam MB, Parizad-Benam S. Studying the effect of emotional intelligence on intentional High risky behaviors of drivers and its dimensions. Security and Social Order Strategic Studies 2017; 6(2): 1-16. [Farsi]

[24]  Souri A, Momeni E, Ahmadkhani B. Investigation And Comparison Of Emotional Intelligence Of Reckless Drivers And Ordinary Drivers In Hamedan City. Hamedan Disciplinary Sciences 2014; 2(4): 69-93. [Farsi]

[25]  Heydareh B, Aslani J, Khoramabadi Y. Coparison between emotional intelligence and personality characters of reckless drivers and ordinary drivers in kermanshah city. Traffic management studies 2016; 5(17): 153-80. [Farsi]

[26]  Asgarian FS, Aghajani M, Alavi NM. Emotional Intelligence and the Occurrence of Accidents in Motorcycle Drivers in Kashan, Iran. J Trauma Nurs 2017; 24(4): 280-6.

[27]  Babaie A, Salehi J, Elahi T. Comparison of Emotional Intelligence and Personality Characteristics of Drivers with Aberrant and Non-aberrant Behaviorsin the City of Zanjan. Advanced Psychological Research 2016; 11(42): 27-50. [Farsi]{C}


 

Investigation of Changes in TC1 Gene Expression Influenced by
Hydro alcoholic Extract of Fennel in Thyroid Cancer Induced in Mice:

An Experimental Study

 

Z. Vahed{C}[3]{C}, Kh. Shahrokhabadi{C}[4]{C}

 

 

Received: 12/02/2019  Sent for Revision: 13/04/2019 Received Revised Manuscript: 15/07/2019 Accepted:  16/07/2019

 

Background and Objectives: Thyroid cancer is the most common malignant endocrine, accounting for 1% of all cancers. One of the most effective genes in thyroid cancer is the TC1 gene. Therefore, this study aimed to determine TC1 gene expression changes under the influence of hydro alcoholic extract of fennel in mice.

Materials and Methods: In this experimental study, hydro alcoholic extract of fennel was prepared. Then, the concentrations required for the experiment were prepared and MTT assay was performed on BCPAP and L929 cells. Simultaneous tumor induction was performed in mice. Then sampling thyroid tissue, RNA extraction and cDNA Synthesis was performed. The results of gene expression changes were evaluated using Real-time technique and analyzed by t-test, ANOVA and Tukey’s test.

Results: The results showed that fennel extract reduced the survival and proliferation of cancer cells. The lowest cell survival was observed at 200 μg/ml, which was significant at the level of p<0.05. Also, TC1 gene expression increased significantly on day 28 after tumor induction and decreased significantly after treatment with extract (p<0.05).

Conclusion: According to the results, the expression of TC1 gene in thyroid malignancies increased. Therefore, it might be possible to use the TC1 gene alone or in combination with other genes as a marker for distinguishing between malignant and benign samples. Treatment with fennel extract also reduced the gene expression, and also reduced and increased cell proliferation, in the cell lines. Therefore, it may be possible to use fennel extract to improve cell proliferation and also to control cancer cells.

Key words: Papillary carcinoma, TC1 gene, MTT assay, Fennel

 

Funding: This research was sponsored by Islamic Azad University.

Conflict of interest: None declared.

Ethical approval: This study was approved by the Ethics Committee of Islamic Azad University, Damghan Branch{C}[11]{C}  (14230553961001).

 

How to cite this article: Vahed Z, Shahrokhabadi Kh. Investigation of Changes in TC1 Gene Expression Influenced by Hydro alcoholic Extract of Fennel in Thyroid Cancer Induced in Mice: An Experimental Study. J Rafsanjan Univ Med Sci 2019; 18 (9): 935-50. [Farsi]


 

{C}[1]{C}- کارشناس ارشد ژنتیک، گروه زیست شناسی، واحد دامغان، دانشگاه آزاد اسلامی، دامغان، ایران

{C}[2]{C}- (نویسنده مسئول) استادیار، دکترای ژنتیک مولکولی، گروه زیست شناسی، واحد مشهد، دانشگاه آزاد اسلامی، مشهد، ایران

تلفن: 8435050-051، دورنگار: 38435050-051، پست الکترونیکی: Shahrokhabady@yahoo.com

 

{C}[3]{C}- MSc in Genetics, Dept. of Biology, Islamic Azad University, Damghan Branch, Damghan, Iran, ORCID: 0000-0002-7343-3478

{C}[4]{C}- Assistant Prof., PhD in Molecular Genetics, Dept. of Biology, Islamic Azad University, Mashhad Branch, Mashhad, Iran

 ORCID: 0000-0002-3536-3456

(Corresponding Author) Tel: (051) 38435050, Fax: (051) 38435050, E-mail: shahrokhabady@yahoo.com


{C}

 {C}[11]{C}تلفن فارسی با انگلیسی مطابقت نذارد. ظاهرا تلفن انگلیسی صحیح است.

{C}[1]{C}- کارشناس ارشد ژنتیک، گروه زیست شناسی، واحد دامغان، دانشگاه آزاد اسلامی، دامغان، ایران

{C}[2]{C}- (نویسنده مسئول) استادیار، دکترای ژنتیک مولکولی، گروه زیست شناسی، واحد مشهد، دانشگاه آزاد اسلامی، مشهد، ایران

تلفن: 8435050-051، دورنگار: 38435050-051، پست الکترونیکی: Shahrokhabady@yahoo.com

 

{C}[3]{C}- MSc in Genetics, Dept. of Biology, Islamic Azad University, Damghan Branch, Damghan, Iran, ORCID: 0000-0002-7343-3478

{C}[4]{C}- Assistant Prof., PhD in Molecular Genetics, Dept. of Biology, Islamic Azad University, Mashhad Branch, Mashhad, Iran

 ORCID: 0000-0002-3536-3456

(Corresponding Author) Tel: (051) 38435050, Fax: (051) 38435050, E-mail: shahrokhabady@yahoo.com


{C}

 {C}[11]{C}تلفن فارسی با انگلیسی مطابقت نذارد. ظاهرا تلفن انگلیسی صحیح است.

نوع مطالعه: پژوهشي | موضوع مقاله: زيست شناسي
دریافت: ۱۳۹۷/۱۱/۱۶ | پذیرش: ۱۳۹۸/۴/۲۵

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2020 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb