جلد 20، شماره 1 - ( 1-1400 )                   جلد 20 شماره 1 صفحات 22-3 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kalhor N, Mirzaie A, Hamdi S M M. Anti-biofilm Effects of Zinc Oxide Nanoparticles Synthesized by Leaf Extract of Typha Latifolia on Biofilm Gene Expression in Multidrug-Resistant Klebsiella Pneumoniae Strains: A Laboratory Study. JRUMS 2021; 20 (1) :3-22
URL: http://journal.rums.ac.ir/article-1-5633-fa.html
کلهر نوید، میرزایی امیر، حمدی محمد مهدی. اثرات ضدبیوفیلمی‌نانوذرات اکسید روی سنتز شده توسط عصاره برگ گیاه لویی (Typha latifolia) بر بیان ژن بیوفیلم در سویه‌های کلبسیلا پنومونیه مقاوم به دارو: یک مطالعه آزمایشگاهی. مجله دانشگاه علوم پزشکی رفسنجان. 1400; 20 (1) :3-22

URL: http://journal.rums.ac.ir/article-1-5633-fa.html


دانشگاه آزاد اسلامی
متن کامل [PDF 678 kb]   (876 دریافت)     |   چکیده (HTML)  (1511 مشاهده)
متن کامل:   (1382 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 20، فروردین 1400، 22-3
 
اثرات ضدبیوفیلمی‌نانوذرات اکسید روی سنتز شده توسط عصاره برگ گیاه لویی
 (
Typha latifolia) بر بیان ژن بیوفیلم در سویه‌های کلبسیلا پنومونیه مقاوم به دارو:
یک مطالعه آزمایشگاهی

 
نوید کلهر[1]،‌ امیر میرزایی[2]، سیدمحمد مهدی حمدی[3]
 
دریافت مقاله:29/07/99  ارسال مقاله به نویسنده جهت اصلاح:26/09/99   دریافت اصلاحیه از نویسنده:17/12/99        پذیرش مقاله: 18/12/99
 
 
 
 
چکیده
زمینه و هدف: بیوفیلم­ها اجتماعی از باکتری­ها بر روی سطوح هستند که توسط مواد پلی‌مری خارج سلولی پوشیده شده‌اند و یکی از راهکارهای از بین بردن بیوفیلم­ها، استفاده از نانوذرات می‌باشد. هدف از این مطالعه سنتز سبز نانوذرات اکسید روی و تعیین اثرات ضدبیوفیلمی‌آن بر روی بیان ژن بیوفلیم در سویه­های کلبسیلا پنومونیه مقاوم به دارو بود.
مواد و روش­ها: در این مطالعه آزمایشگاهی، نانوذرات اکسید روی (ZnO) به روش سبز با استفاده از محلول نیترات روی و عصاره گیاه لوئی (Typha latifolia) سنتز گردید. خصوصیات فیزیکی و شیمیایی آن توسط روش­های میکروسکوپ الکترونی نگاره (Scanning electron microscopy)، میکروسکوپ­الکترونی­گذاره (Transmission electron microscopy) و FTIR (Fourier-transform infrared spectroscopy)  تأیید گردید. به دنبال اثرات ضدمیکروبی و ضدبیوفیلمی‌آن بر روی ایزوله­های کلبسیلا پنومونیه مقاوم به دارو  به ترتیب با استفاده از روش­های حداقل غلظت مهارکنندگی و میکروتیتر پلیت بررسی شد. در انتها، اثرات نانوذرات اکسید روی بر بیان ژن بیوفیلم wzm با روش Real Time PCR بررسی شد.
یافته­ها: نانوذرات اکسید روی سنتز شده دارای مورفولوژی کروی بوده و دارای اندازه زیر 100 نانومتر بود. نتایج نشان داد که نانوذرات اکسید روی سنتز شده دارای اثرات معنادار ضدمیکروبی و ضدبیوفیلمی‌علیه سویه­های کلبسیلا پنومونیه مقاوم به دارو بودند و این نانوذرات بیان ژن بیوفیلم wzm را به طور معناداری کاهش دادند (P<0.05).
نتیجه­گیری: یافته­های این مطالعه نشان داد که نانوذرات اکسید روی سنتز شده دارای اثرات ضدمیکروبی و ضدبیوفیلمی‌چشمگیری بوده و در آینده می­توان با مطالعات بیشتر از این نانوذره به عنوان ترکیب ضدبیوفیلم استفاده نمود.
واژه­های کلیدی: نانوذرات اکسید روی، کلبسیلا پنومونیه، ضدمیکروبی، ضدبیوفیلمی، بیان ژن بیوفیلم
 
 
 
 
 
 
 
 
 
 
 
مقدمه
کلبسیلا پنومونیه (Klebsiella pneumoniae) یک باکتری میله­ای گرم­منفی، بیهوازی اختیاری و غیرمتحرک است که متعلق به خانواده انتروباکتریاسه است. در بسیاری از کشورها به دلیل مصرف بی­رویه آنتی بیوتیک­ها سویه­های کلبسیلا پنومونیه به بسیاری از آنتی­بیوتیک‌ها مقاوم شده­اند و می‌توانند آنزیم­های مختلف مانند بتالاکتامازهای وسیع الطیف جهت مقاومت به آنتی بیوتیک­ها تولید کنند. هم چنین یکی از مکانیسم­های مقاومت آنتی­بیوتیکی در این باکتری تولید بیوفیلم می­باشد و در واقع بیوفیلم جمعیتی از باکتری­ها میباشند که درون یک ماتریکس خارج سلولی محبوس شدهاند [1]. این ماتریکس متشکل از پروتئین‌ها، اگزوپلی ساکارید،‌ DNA و لیپوپپتیدها می­باشد. سویه­های کلبسیلا پنومونیه با تشکیل بیوفیلم می‌توانند از دسترس سیستم ایمنی و آنتی بیوتیک‌ها دور بمانند و منجر به ایجاد مقاومت آنتی بیوتیکی می­شوند [2]. به طور کلی ژنهای متنوعی در تشکیل بیوفیلم در سویه‌های کلبسیلا پنومونیه نقش دارند. برخی از این ژنها در تولید اگزوپلی ساکاریدها (لیپوپلی ساکارید و کپسول) و نهایتا تشکیل بیوفیلم نقش دارند. یکی از ژنهای تولید بیوفیلم ژن wzm در کلبسیلا پنومونیه می‌باشد که نقش به سزایی در تولید بیوفیلم دارد که مسئول سنتز آنتی ژن O در ساختار لیپوپلی ساکارید می‌باشد. ژن wzm مربوط به خوشی ژنی wb می‌باشد که آنزیم‌های سنتز کننده آنتیژن O لیپوپلی ساکارید را کد می‌کند که نقش مهمی در تشکیل بیوفیلم دارد. مطالعات نشان داده است که موتانت‌های فاقد ژن wzm نمی‌تواند تشکیل بیوفیلم دهند. همچنین مطالعات نشان می‌دهد که بیان ژن wzm در ارتباط با ژنهای حس حد نصاب (Quorum sensing)‌ نیز می‌باشد [2]. بنابراین محققان به دنبال راهکارهای درمانی جایگزین برای کنترل عفونت­های ناشی از کلبسیلا پنومونیه دارند که یکی از این راهکارها استفاده از پلیمرهای طبیعی، سنتتیک و فلزی می‌باشد [3]. در میان نانوذرات، نانوذرات فلزی مانند اکسید روی (ZnO) توجه محققان را به خود جلب کرده است و دارای خصوصیات ویژه­ای مانند پایداری در شرایط محیطی و سنتز در دماهای پایین می­باشد [3].
به طور کلی روش­های مختلفی جهت سنتز نانوذرات فلزی وجود دارد که یکی از این روش­ها روش سنتز سبز یعنی سنتز نانوذرات با استفاده از عصاره گیاهان می‌باشد [4]. در این مطالعه، عصاره گیاه لوئی (Typha latifolia) جهت سنتز نانوذرات اکسید روی استفاده شد (شکل 1). مطالعات نشان می‌دهد که عصاره این گیاه دارای ترکیبات ثانویه مانند ترپن‌ها، ترپنوئیدها و فلاوونوئیدها می‌باشند که دارای اثرات احیاء کنندگی بوده و در سنتز نانو ذرات حایز اهمیت می‌باشد [5]. با توجه به مقاومت روز افزون سویه‌های کلبسیلا پنومونیه به آنتی بیوتیک‌ها و گسترش بیوفیلم، استفاده از راهکارهای جایگزین جهت از بین بردن بیوفیلم و مقاومت آنتی بیوتیکی این سویه­ها دارای اولویت می‌باشد و یکی از راهکارها استفاده از نانوذرات می‌باشد و بنابراین هدف از این مطالعه سنتز سبز انوذرات روی (ZnO) از عصاره گیاه لویی (Typha latifolia) به منظور بررسی اثرات ضدمیکروبی و ضدبیوفیلمی‌ آن علیه سویه­های کلبسیلا پنومونیه مقاوم به دارو می‌باشد. تاکنون مطالعات مختلفی در زمینه بررسی اثرات ضد باکتریایی و ضد بیوفیلمی‌ نانوذرات اکسید روی انجام شده است، اما ما در این مطالعه برای اولین بار از عصاره یکی از گیاهان بومی‌کشور به نام لوئی جهت سنتز نانوذرات اکسید روی استفاده نموده­ایم که سرعت واکنش و نوع نانو ذرات اکسید روی سنتز شده با مطالعات دیگر تفاوت دارد [6] به این شکل که نوع ترکیبات فیتوشیمیایی گیاهان مختلف متفاوت است و میتواند در افزایش اثر میکروب کشی نانو ذرات سنتز شده دخالت داشته باشد.
 
شکل 1- تصویری از گیاه لویی.
 
مواد و روش­ها
در این مطالعه آزمایشگاهی که از آذرماه 1398 تا مرداد ماه 1399 در دانشگاه آزاد اسلامی واحد تهران مرکزی انجام گرفت، گیاه لویی (Typha latifolia) از استان گیلان (کیلومتر 4 سیاهکل به سمت لاهیجان از جاده شهرک صنعتی، حاشیه جاده مجاور مزارع برنج) جمع آوری شد و توسط گیاه شناس (دکتر محمد مهدی حمدی، دانشگاه آزاد اسلامی‌واحد تهران مرکزی، گروه زیست شناسی) مورد تایید گرفت و برای آن کد هرباریومی‌1286 در نظر گرفته شد. برای تهیه عصاره آبی گیاه، 10 گرم از برگ گیاه، خشک و سپس آسیاب گردید و عصاره گیری با استفاده از روش ماسراسیون انجام شد. به طور خلاصه، در ابتدا 5 گرم از پودر عصاره گیاه وزن گردید و سپس 100 سی سی آب مقطر به‌ عنوان حلال افزوده شد. پودر گیاه به مدت 48 ساعت در تماس با حلال بر روی همزن مغناطیسی قرار گرفت و بعد از مدت تعیین‌شده، آن را صاف کرده و به منظور تغلیظ کردن آن از دستگاه روتاری (R100، ژال تجهیز، ایران) استفاده شد و در نهایت عصاره با غلظت 10 میلی‌گرم در میلی‌لیتر جهت ادامه مطالعه تهیه شد [7].
برای سنتز زیستی نانو ذرات اکسید روی با خلوص بالا ابتدا 200 میلی‌لیتر از محلول مایع نیترات روی (5/1 میلیمولار) به 20 میلیلیتر از محلول عصاره برگ گیاه لویی اضافه گردید و سپس با 10 میلیلیتر سدیم هیدروکسید (1 مولار)  تیمار شد. ترکیب حاصل در تاریکی و در دمای 60 درجه سانتیگراد و بر روی استیرر (MS300HS، ژال تجهیز، ایران) انکوبه شد. بعد از 24 تشکیل رنگ سفید که نشان دهنده ظهور نانو ذرات اکسید روی است مشاهده گردید. محلول حاصل برای خالصسازی بیشتر  سانتریفیوژ (سیگما، مدل 16/2، آمریکا) شده و با آب مقطر و سپس با اتانول شسته شده و خشک گردید [7]. جهت تأیید ساختار نانو ذرات اکسید روی سنتز شده از روش‌های زیر استفاده گردید:
1- آنالیز طیف سنجی مرئی فرابنفش: بعد از گذشت 120 دقیقه از زمان واکنش افزوده عصاره به نیترات روی و تغییر رنگ واکنش، آنالیز طیف سنجی مرئی فرابنفش نانوذرات روی با استفاده از دستگاه طیف سنجی UV-Vis (Agilent, Cary 300،Spectrophtometer, USA) بین 200 تا 700 نانومتر مورد ارزیابی قرار گرفت. 
2- میکروسکوپ الکترونی گذاره (Transmission electron microscopy, TEM): به منظور بررسی ریخت شناسی و تأیید اندازه نانو ذرات اکسید روی، عکس برداری از نانو ذرات اکسید روی توسط دستگاه EM10C-100 KV Zeiss کشور آلمان، انجام گردید.
3- میکروسکوپ الکترونی گذاره (Transmission electron microscopy, SEM): ریخت شناسی و اندازه نانو ذرات روی سنتز شده به روش زیستی با استفاده از میکروسکوپ الکترونی روبشی (SEM) بررسی شد. عکس برداری SEM توسط دستگاه MIRA شرکت TE-SCAN ساخت کشور ژاپن انجام گردید.
4- الگوی پراش اشعه ایکس X-ray powder diffraction (XRD)): به منظور تعیین فازهای بلورین (کریستالی) نانوذرات اکسید روی سنتز شده همچنین اندازه­گیری ثابتهای کریستالی نانو ذرات اکسید روی از الگوی پراش اشعه ایکس (XRD)‌ نمونه‌ها بهره استفاده شد. تفرق اشعه ایکس امکان شناخت نوع ساختار کریستالوگرافی نانوذرات اکسید روی را فراهم می‌کند. در این مطالعه آزمون اشعه ایکس توسط دستگاه XRD (Explorer، GNR، Italy) با تشعشع لامپ CuKa، در دامنه 0 تا 110 درجه انجام شد.
5- طیف سنجی مادون‌قرمز (Fourier-transform infrared spectroscopy): طیف‌سنجی مادون ‌قرمز می‌تواند گروههای عاملی مختلف موجود بر روی ترکیبات مولکولی را شناسایی کرده و در نتیجه ساختار احتمالی ترکیبات را برای ما مشخص کند. با استفاده از دستگاه مدل Spectrum Two  از شرکت PerkinElmer (ژاپن)، طیف نگاری مادون‌ قرمز انجام گردید.
در این مطالعه، تعداد 50 نمونه مشکوک به کلبسیلا پنومونیه از بیماران مراجعه کننده بیمارستانهای مختلف (پارس، امام خمینی و شهدای یافت آباد) شامل ادرار، زخم، مایع مغزی-نخاعی، خون و خلط جمع آوری شدند. نمونه­ها پس از انتقال به آزمایشگاه تحقیقاتی میکروبشناسی دانشگاه آزاد واحد تهران مرکزی روی محیط­های Eosin Methylene Blue (EMB) (مرک-آلمان) و مک کانکی آگار (مرک-آلمان) کشت داده شدند و در 37 درجه سانتی گراد به مدت 24 ساعت نگهداری شدند. بعد از تهیه لام و مشاهده باسیل‌های گرم منفی، تست‌های بیوشمیایی معمول نظیر کشت در محیط‌های کشت Sulfide indole motility (SIMTriple sugar iron agar (TSIMethyl Red (MR) and Voges-Proskauer (VP) (MRVP) (مرک-آلمان)، اوره و سیترات و تست اکسیداز (مرک-آلمان) برای تأیید کلبسیلا پنومونیه انجام شد. سپس باکتری‌ها در محیط Tryptic Soy Broth (TSB)(مرک، آلمان) و گلیسرول (مرک-آلمان) در70- درجه سانتی گراد برای انجام تست‌های بعدی مطالعه و ذخیره شدند [8].
الگوی مقاومت آنتی بیوتیکی سویه­های کلبسیلا پنومونیه توسط روش دیسک دیفیوژن بر اساس استاندارد Clinical and Laboratory Standards Institute (CLSI) انجام گرفت [9]. ابتدا غلظت نیم مک فارلند از تمامی سویه­ها تهیه شد و در محیط کشت مولرهینتون آگار کشت داده شد و میزان حساسیت سویه­ها به آنتی­بیوتیک­های آمپی­سیلین، جنتامایسین، آمیکاسین، تتراسایکلین، سفپیم، سیپروفلوکساسین، لووفلوکساسین و تری متوپریم سولفامتاکسازول (پادتن طب-ایران) بررسی شد [9].
روش مورداستفاده در تست فنوتیپی روش مورد استفاده Freeman و همکاران می‌باشد. در این روش از محیط کشت کنگو رد آگار استفاده شد. این محیط کشت حاوی محیط (37 گرم در لیتر) Brain heart infusion (BHI) (مرک-آلمان)، سوکروز (50 گرم در لیتر)، آگار (10 گرم در لیتر)( مرک-آلمان) و رنگ کنگو رد (8/0 گرم در لیتر) مرک-آلمان) می‌باشد. سویه‌های بالینی کلبسیلا پنومونیه در پلیت حاوی محیط کشت کنگورد به مدت 24 ساعت در دمای 37 درجه سانتی گراد کشت داده شدند. تحت چنین شرایطی سویه‌های تولید کننده بیوفیلم کلنی‌های مشکی رنگ و سایر سویه‌ها کلنی‌های قرمز رنگ تشکیل می‌دهند [10].
به منظور بررسی اثرات ضدمیکروبی نانوذرات اکسید روی از روش میکرودایلوشن در پلیت 96 خانه ای بر طبق پروتوکل‌های CLSI استفاده شد. به این منظور ابتدا سویه‌های کلبسیلا پنومونیه در محیط کشت مولر هینتون براث به مدت 24 ساعت در دمای 37 درجه سانتی گراد کشت داده شدند. نانوذره در غلظت‌های 95/1 میکروگرم در هر میلیلیتر تا 500  میکروگرم در هر میلیلیتر به داخل چاهک‌ها ریخته و با محیط کشت مولر هینتون براث (MHB :Mueller-Hinton broth) (مرک-آلمان)، تا حجم 195 میکرولیتر رسانده شد. همهی چاهک‌ها با مقدار 5 میکرولیتر از کشت میکروبی سویه‌های کلبسیلاپنومونیه با غلظت نیم مک فارلند اضافه گردید. مقدار MIC (Minimum inhibitory concentration) به‌عنوان کمترین غلظت مهارکننده رشد باکتری محسوب می‌شود. لازم به ذکر است که جهت تعیین غلظت MIC، از چاهک حاوی باکتری فاقد نانو ذره به‌عنوان کنترل منفی و از چاهک حاوی نانو ذره به همراه محیط کشت به عنوان کنترل مثبت استفاده گردید [10].
به منظور مطالعه کمی اثرات ضد بیوفیلمی‌ نانوذره اکسید روی از روش میکروتیترپلیت استفاده شد. سپس یک کشت 24 ساعته از هر ایزوله تهیه گردید و سپس با برداشتن از کلنی­های کشت 24 ساعته و تلقیح آن‌ها به محیط TSB حاوی 2/0 گلوکز، سوسپانسیون میکروبی به دست آمد که کدورت آن با کدورت نیم مک فارلند تطابق داشت. از محیط TSB بدون تلقیح باکتری به همه چاهک­ها اضافه شد چاهک 12 کنترل منفی (بدون باکتری) و چاهک‌های ستون 11 به‌عنوان کنترل مثبت (حاوی 100 میکرولیتر سوسپانسیون باکتری) در نظر گرفته شد. سپس به هر یک از چاهک‌های 100 پلیت میکرولیتر از هر سوسپانسیون باکتریایی اضافه شد و به دنبال آن 50 میکرولیتر از غلظت‌های زیر حدکشندگی نانوذره روی به آن اضافه گردید و سپس پلیت به مدت 24 ساعت در دمای 37 درجه سانتی گراد انکوبه شد. بعد از گذشت 24 ساعت، محلول رویی چاهک‌ها را خارج گردید و هر چاهک 3 مرتبه با سرم فیزیولوژی استریل شسته شد. سپس باکتری‌های متصل به دیواره با 250 میکرولیتر از اتانل 96% تثبیت شدند. بعد از 15 دقیقه محتویات چاهک خالی شدند. بعد از خشک شدن پلیت‌ها به آن 200 میکرولیتر رنگ کریستال ویوله اضافه گردید (به مدت 15 دقیقه). بعد از گذشت این مدت‌زمان، رنگ‌های اضافی با استفاده از آب مقطر استریل شسته شدند. بعد از خشک کردن پلیت­ها، سنجش کمی‌ بیوفیلم به وسیله اضافه کردن 200 میکرولیتر اسید استیک 33 درصد به هر چاهک صورت گرفت و جذب آن در طول موج 570 نانومتر توسط دستگاه ELISA Reader (JASCO, V-530، ژاپن) خوانده شد [10].
به منظور بررسی میزان تغییرات بیان ژن بیوفیلم wzm در سویه‌های تشکیل دهنده بیوفیلم، از روش quantitative Real Time PCR استفاده می‌شود. به این منظور ابتدا سویه‌های کلبسیلا پنومونیه با غلظت زیرحد مهار کنندگی (Sub-minimum inhibitory concentration) تیمار شدند و RNA سلول توسط کیت استخراج RNA (Bioneer, Korea) استخراج گردید. RNA‌های استخراج شده توسط کیت سنتز cDNA (TaKara, Japan) به DNA مکمل (cDNA)‌ تبدیل گردید. جهت انجام تست Real Time PCR، از  پرایمر اختصاصی ژن‌ هدف wzm  استفاده نموه و ژن 16S rRNA به عنوان کنترل داخلی مورد استفاده قرار گرفت. توالی پرایمرهای رفت و برگشت (Forward and reverse) ژن هدف wzm به صورت 5'- TGCCAGTTCGGCCACTAAC -3'  رفت، و  5'- GACAACAATAACCGGGATGG -3'  برگشت، بود. توالی پرایمرهای رفت و برگشت ژن مرجع 16S rRNA به صورت 5'-CGTCTGCCCTATCAACTTTCG-3' رفت، و  5'-CGTTTCTCAGGCTCCCTCT-3'  برگشت است [11]. 
در ادامه، اختلاف چرخه­های آستانه به دست آمده از نمونه‌های مورد آزمایش (نمونه­های تیمار شده با نانوذره) و نمونه‌های کنترل (نمونه­های تیمار نشده با نانوذره) محاسبه و میزان بیان ژن با استفاده از فرمول ΔΔCt، نسبت ژن‌ هدف به ژن مرجع (16S rRNA) از طریق 2 –ΔΔCt محاسبه شد.
تمامی‌تست‌های این مطالعه به صورت 3 بار تکرار بوده و محاسبه آماری این مطالعه با استفاده از نرمافزارSPSS  نسخه 16 انجام گردید.
از آزمون Shapiro-wilk برای بررسی نرمال بودن توزیع میانگین‌ها استفاده شد و نتایج با آنالیز واریانس یک طرفه (one-way analysis of variance) مورد بررسی قرار گرفت و اطلاعات به صورت انحراف معیار ± میانگین نمایش داده شده‌اند و سطح معنی­داری در آزمون­ها 05/0 در نظر گرفته شد.
نتایج
در طی فرآیند سنتز، یون‌های Zn در معرض ترکیبات احیاء کننده عصاره گیاه قرارگرفته و از این طریق کاهش نمک روی شروع می‌شود. احیای کامل یون‌های Zn به نانو ذرات اکسید روی با تغییر رنگ محیط و طیف‌سنجی انجام شد. تغییر رنگ نشان دهنده احیای نمک روی و تشکیل نانو ذرات روی در محلول است (شکل 2).
 
 
 
A
B
 
 
 
 
 
 
 
 

شکل 2- سنتز سبز نانوذرات اکسید روی
(A): محلول نیترات روی، (B): نانوذرات اکسید روی سنتز شده.
 وجود پیک در طول موج 340 نانومتر برای نانو ذرات اکسید روی با دستگاه طیف‌سنجی UV-vis طی زمان‌های مختلف واکنش تأیید شد (شکل 3).
 

 
 
 
 
 
 
 
 
شکل 3- طیف سنجی UV برای نانوذرات اکسید روی سنتز. وجود پیک شاخص در طول موج 340 نانومتر نشان دهنده سنتز احتمالی نانو ذرات اکسید روی می باشد.
 
 اندازه و ریخت شناسی نانو ذرات از طریق میکروگراف میکروسکوپ الکترونی نگاره (SEM) مورد ارزیابی قرار گرفت. اندازه و ریخت‌شناسی نانو ذرات اکسید روی توسط SEM با ولتاژ زیر 30 کیلو ولت و با بزرگنمایی‌های مختلف، تحت فشار خلاء (Torr 5-10) مورد ارزیابی قرار گرفت. همان گونه که در شکل 4 مشخص است، اندازه نانو ذرات بین60 تا 110 نانومتر متغیر بوده است. همچنین، تصاویر میکروسکوپ الکترونی گذاره TEM نشان می­دهد که نانو ذرات سنتز شده دارای ساختار کروی می‌باشند )شکل 5(.
 

 
 
 
 
 
شکل 4- تصاویر میکروسکوپ الکترونی SEM از نانوذرات روی سنتز شده. همانطور که مشاهده می شود که نانوذرات کروی و زیر 100 نانومتر میباشند.

 
 
 
 
شکل 5- تصویر میکروسکوپ الکترونی TEM که نشان دهنده ساختار کروی نانوذرات اکسید روی سنتز شده است.
 
 
آنالیزXRD  به منظور تأیید تشکیل نانو ذرات اکسید روی انجام گرفت. الگوی طیف به‌دست‌آمده از ویرایش اشعه ایکس در زاویه θ دارای پیک­های 56/46، 29/36، 45/34، 28/33، 8/33 بود که با الگو پراش اشعه ایکس ZnO مطابقت دارد (شکل 6). در طیف‌سنجی FTIR نانو ذرات اکسید روی، باندهای جذبی در نواحی ناحیه 1014 و ناحیه 1048 مربوط به ترکیبات اتری (C-O-C) است که می‌تواند بر اثر واکنش با عصاره گیاهی ایجاد شده باشد. باندهای جذبی ناحیه 2368 و  ناحیه 3344 در طیف‌سنجی نانو ذرات اکسید روی مربوط به واکنش عصاره گیاهی با نیترات روی بوده است. هم­چنین باند cm-11595 برای ترکیبات روی دار گزارش‌شده است (شکل 7).
 

شکل 6- آنالیز XRD نانوذرات اکسید روی سنتز شده. نتایج XRD نشان دهنده سنتز نانوذرات اکسید روی می باشد. الگوی طیف به‌دست‌آمده از ویرایش اشعه ایکس در زاویه θ دارای پیک­های 56/46، 29/36، 45/34، 28/33، 8/33 بود که با الگو پراش اشعه ایکس ZnO مطابقت دارد.

 
شکل 7- آنالیز FTIR نانوذرات اکسید روی سنتز شده. وجود پیک های مختلف نشان دهنده پیوندهای مختلف ترکیبات گیاهی بر روی سطح نانوذرات اکسید روی می باشد ). در طیف‌سنجی FTIR نانو ذرات اکسید روی، باندهای جذبی در نواحی ناحیه 1014 و ناحیه 1048 مربوط به ترکیبات اتری (C-O-C) است که می‌تواند بر اثر واکنش با عصاره گیاهی ایجاد شده باشد. باندهای جذبی ناحیه 2368 و  ناحیه 3344 در طیف‌سنجی نانو ذرات اکسید روی مربوط به واکنش عصاره گیاهی با نیترات روی بوده است. هم­چنین باند cm-11595 برای ترکیبات روی دار گزارش ‌شده است
 
در این مطالعه از بین 50 نمونه بالینی مشکوک به کلبسیلا پنومونیه، کلنی­های لاکتوز مثبت و موکوئیدی جداسازی شد و با استفاده از تست­های میکروسکوپی و بیوشیمیایی تعداد 20 سویه کلبسیلا پنومونیه جداسازی گردید )جدول 1(.
 
 
جدول 1- محل جداسازی سویه های کلبسیلا پنومونیه مقاوم به دارو و الگوی مقاومت آنتی بیوتیکی.
شماره سویه نوع نمونه بالینی الگوی مقاومت آنتی بیوتیکی
4 ادرار آمپی سیلین، جنتامایسین، تتراسایکلین
7 خون آمیکاسین، لووفلوکساسین، و تری متوپریم سولفامتاکسازول
9 ادرار جنتامایسین، سفپیم، تتراسایکلین
12 ادرار سفپیم، سیپروفلوکساسین، تتراسایکلین
16 خلط آمپی­سیلین، سیپروفلوکساسین، تری متوپریم سولفامتاکسازول
21 ادرار آمپی­سیلین، آمیکاسین، لووفلوکساسین
26 ادرار سفپیم، سیپروفلوکساسین، تتراسایکلین
34 خون آمیکاسین، لووفلوکساسین، و تری متوپریم سولفامتاکسازول
35 ادرار آمپی سیلین، جنتامایسین، تتراسایکلین
37 ادرار آمپی­سیلین، آمیکاسین، لووفلوکساسین
39 ادرار سفپیم، سیپروفلوکساسین، تتراسایکلین
42 ادرار آمیکاسین، لووفلوکساسین، و تری متوپریم سولفامتاکسازول
45 ادرار جنتامایسین، سفپیم، تتراسایکلین
48 خون آمیکاسین، لووفلوکساسین، و تری متوپریم سولفامتاکسازول
49 ادرار آمپی­سیلین، آمیکاسین، لووفلوکساسین
 
 
نتایج مقاومت آنتی­بیوتیکی نشان داد که تعداد 15 نمونه )75 درصد( دارای الگوی مقاومت آنتی بیوتیکی (multidrug-resistant : MDR) بودند. (MDR: سویه­های دارای مقاومت به یکی از آنتی­بیوتیک­ها از سه خانواده مختلف آنتی بیوتیکی). در این مطالعه به منظور تشخیص سویه­های تشکیل دهنده بیوفیلم از محیط کشت کنگوردآگار استفاده شد. نتایج نشان داد تمامی‌سویه­های MDR )15 سویه( تشکیل دهنده بیوفیلم بودند، به طوری که سویه‌های تشکیل دهنده دارای کلنی­های مشکی رنگ بر روی محیط کشت کنگو رد آگار بودند (شکل 8).
در این مطالعه به منظور مطالعه اثرات ضد میکروبی نانوذرات اکسید روی از روش رقت‌سازی متوالی در پلیت 96 خانه­ای استفاده شد. نتایج نشان داد که نانوذرات اکسید روی دارای اثرات ضد میکروبی معناداری دارند و میزان MIC سویهها بین 5/62-8/7 می‌باشد به طوری که کمترین MIC 9/3 و بیشترین MIC 25/31 میکروگرم در میلی‌لیتر میباشد (جدول 2).
 

شکل 8- تست تشکیل بیوفیلم در محیط کشت کنگو رد آگار. سویههای تشکیل دهنده بیوفیلم در محیط کشت کنگو رد آگار کلنی مشکی رنگ (a) و سویههای بیوفیلم منفی کلنیهای سفید رنگ تشکیل میدهند (b).
جدول 2- میزان کمترین غلظت مهارکنندگی (MIC) سویههای مختلف کلبسیلا پنومونیه از میان بیماران مراجعه کننده بیمارستا‌‌‌نهای مختلف شهر تهران در سال 98-1397.
 
شماره سویه غلظت MIC (میکروگرم در میلی‌لیتر) شماره سویه غلظت MIC (میکروگرم در میلی‌لیتر)
4 5/62 35 62/15
7 62/15 37 8/7
9 8/7 39 8/7
12 8/7 42 25/31
16 5/62 45 5/62
21 62/15 48 8/7
26 5/62 49 5/62
34 8/7 ATCC 13883 62/15
 
 
به منظور بررسی اثرات ضدبیوفیلمی‌نانوذرات اکسید روی از روش میکروتیترپلیت استفاده شد. نتایج اثرات ضد بیوفیلمی‌ نشان داد که نانوذرات اکسید روی می­توانند تشکیل بیوفیلم را به طور معناداری کاهش دهند (نمودار 1). همچنین نتایج Real Time PCR نشان داد که پس ار تیمار سویه­های تشکیل دهنده بیوفیلم با غلظت زیر حد مهار کنندگی نانو ذرات اکسید روی میزان بیان ژن wzm  در تمامی‌سویه­ها نسبت به ژن مرجع 16S rRNA کاهش معناداری داشته است (05 /0P<)، به طوری که در برخی از سویه­ها میزان بیان 5 برابر کاهش یافته بود (نمودار 2). 
 

 
نمودار 1- اثرات ضدبیوفیلمی نانوذرات اکسید روی توسط روش میکرو تیتر پلیت. داده به صورت مقایسه با نمونه قبل از تیمار مقایسه شده‌اند
 (*** 001/0P< (اختلاف معناداری با گروه قبل از تیمار (کنترل) : 3n=). نتایج با آنالیز واریانس یک طرفه مورد بررسی قرار گرفت. ستون افق مربوط به شماره سویه‌های کلبسیلا پنومونیه و محور عمودی میزان جذب در طول موج 570 نانومتر را نشان می‌دهد (میزان تشکیل بیوفیلم). ستونهای با هاشور مشکی رنگ مروبط به سویه‌های کلبسیلا پنومونیه قبل از تیمار و ستون‌های با هاشور طوسی رنگ مربوط به همان سویه‌ها بعد از تیمار با نانوذرات اکسید روی می‌باشد.
a
b
 
 
 
 
 
 
 
 
 
 
 

c

 
 
 
 
نمودار 2- نمودار تکثیر (a) و آنالیز منحنی ذوب ژ‌‌نهای wzm  و 16S rRNA (b). میزان تغییرات بیان ژن wzm  در سویه‌های تشکیل دهنده بیوفیلم (c). میزان بیان ژن بیوفیلم wzm  درسویه‌ها پس از تیمار با نانوذرات روی به طور معناداری کاهش یافته اند (*** 001/0P < اختلاف معناداری با گروه کنترل : 3n=). نتایج با آنالیز واریانس یک طرفه مورد بررسی قرار گرفت. محور افقی شماره سویه‌های کلبسیلا پنومونیه و محور عمودی میزان بیان ژن می باشد. ستون‌های سفید رنگ مربوط به ژن کنترل و ستون مشکلی مربوط به ژن wzm می باشد.
 
 
بحث
امروزه با توجه به مصرف بی­رویه آنتی بیوتیک­ها بسیاری از پاتوژن‌های میکروبی بخصوص کلبسیلا پنومونیه به دلیل تشکیل بیوفیلم آنتی بیوتیک‌ها مقاوم شده‌اند. اخیراً استفاده از ترکیبات طبیعی و نانوذرات جهت از بین بردن سد مقاومت آنتی­بیوتیکی و تولید بیوفیلم مورد توجه محققان قرار گرفته­اند [12]. در این مطالعه نانوذرات اکسید روی با استفاده از روش سنتز سبز توسط عصاره گیاه لویی (به دلیل داشتن محتوای فلاوونوئیدی و ترپنوئیدی) تولید گردید و خصوصیات فیزیکی و شیمیایی آن مورد تأیید قرار گرفت. نتایج نشان داد که موروفولوژی نانوذرات اکسید­روی سنتز شده کروی بوده و سایز آنها کمتر از 110 نانومتر می‌باشد که یک جنبه مثبت در نانوذرات بخصوص نانوذرات فلزی می‌باشد، به طوریکه مطالعات نشان داده است که نانوذرات دارای سایز کوچک­تر دارای اثرات ضدمیکروبی بیشتری هستند [13].
  Pillaiو همکارانش نانوذرات اکسید روی را با استفاده از روش سنتز سبز با عصاره گیاهان Beta vulgaris, Cinnamomum tamala, Cinnamomum verum, Brassica oleracea var. Italica سنتز نمودند. نتایج این مطالعه نشان داد که نانوذرات سنتز شده دارای ساختار کروی بوده و دارای اندازه 20 نانومتر می‌باشد [14]. Naseer و همکارانش نانوذرات اکسید روی را با استفاده از روش سنتز سبز، سنتز نمودند. نتایج این مطالعه نشان داد که نانوذرات سنتز شده دارای سایز 1/68 نانومتر و کروی می‌باشد [15]. نقطه نظر مشابه تمامی مطالعات با مطالعه ما این نکته می‌باشد که روش سنتز سبز برای سنتز نانوذره روی یک روش راحت و مقرون به صرفه است و اختلاف در سایز نانو ذره مربوط به نوع گونه گیاهی مورد استفاده است، به طوری که مطالعات نشان می‌دهد که گونه‌های مختف گیاهی باعث سنتز نانوذرات با اندازه­های مختلف می­شود. همچنین یکی از اختلافات این مطالعات با مطالعات میزان غلظت مهارکنندگی نانوذرات علیه باکتری‌ها می‌باشد که می‌تواند به دلیل نوع باکتری‌های مورد مطالعه و میزان مقاومت آنتی بیوتیکی آن‌ها باشد [16].
Zare و همکارانش نانوذرات اکسید روی را با استفاده از Cuminum cyminum سنتز نمودند و خصوصیات نانوذرات سنتز شده با استفاده از تست UV و میکروسکوپ الکترونی گذاره مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که نانوذرات سنتز شده در طول موج 370 نانومتر بیشترین جذب را داشته و نانوذرات دارای شکل ظاهری کروی و با اندازه میانگین 7 نانومتر بودند [17]. اندازه نانوذرات سنتز شده در این مطالعه با مطالعه اختلاف داشت که یکی از دلایل اندازه‌های مختلف نانوذرات سنتز شده می‌تواند نوع عصاره استفاده شده باشد. مطالعات نشان می‌دهد ارتباط معناداری بین عصاره گیاهان مختلف و سایز نانوذره سنتز شده وجود دارد به این ترتیب گیاهانی که محتوای فلاوونوئیدی بیشتری دارند می‌توانند نانوذرات با اندازه‌های کوچک‌تر را تولید کنند [18].   
در ادامه یکی دیگر از اهداف این مطالعه تعیین اثرات ضد میکروبی، ضد بیوفیلمی‌ و تأثیر آن بر روی بیان ژن بیوفیلم wzm در سویه‌های کلبسیلا پنومونیه بود. نتایج مطالعه ما نشان داد نانوذرات اکسید روی می­توانند اثرات ضدباکتریایی معناداری داشته باشند که به طوری که در غلظت‌های پایین نانوذرات اثرات میکروب کش قوی مشاهده شد. مکانیسم‌های متعددی جهت خواص ضدمیکروبی نانوذرات اکسید روی وجود دارد. مطالعات نشان می‌دهد که تماس مستقیم نانوذرات اکسید روی با دیواره سلولی که منجر به تخریب دیوار سلولی می‌شود و یا آزادسازی یون‌های Zn2+ و رادیکال‌های سمی  اکسیژن می‌باشد که دارای اثرات ضد میکروبی هستند. سمیت سلولی ناشی از رادیکال‌های سمی اکسیژن به دلیل واکنش پذیری بالا و خاصیت اکسیداسیون آن می­باشد [19]. Raghupathi و همکارانش نشان دادند که افزایش خاصیت ضد میکروبی نانو ذرات اکسید روی به دلیل افزایش تولید رادیکال‌های سمی اکسیژن می­باشد. این رادیکال‌های سمی‌اکسیژن شامل آنیون سوپراکسید (O2)، هیدروژن پراکسید (H2O2) و هیدروکسید (OH-) می­باشد. سمیت سلولی این ترکیبات به خاطر تخریب اجزای سلولی مانند لیپید، DNA، پروتئین‌ها و غشای سلولی می­باشد. همچنین آزادسازی یون‌های Zn2+ باعث مهار انتقال فعال غشای سلول باکتری و هم چنین متابولیسم اسیدآمینه و تخریب عملکرد سیستم آنزیمی‌ می­شود [20].   
نتایج تاثیر نانوذرات روی بر روی بیان ژن بیوفیلم wzm نشان داد که بیان ژن wzm در سویه‌ها نسبت به ژن کنترل کاهش معناداری داشته است که می‌تواند در کاهش تشکیل بیوفیلم نقش داشته باشد. میزان کاهش بیان ژن در سویه‌های مختلف متفاوت است به طوری که در برخی از سویه‌ها باعث کاهش بیان 2 برابری و در برخی دیگر کاهش 5 برابری شده است. همچنین ارتباط معناری بین الگوی مقاومت آنتی بیوتیکی و تأثیر نانوذره بر بیان ژن مشاهده نشد. مطالعات نشان می‌دهد که نانوذرات می‌توانند بر روی فاکتورهای رونویسی (Transcription factors) اثر بگذارند و فعالیت آنها را کاهش دهند و بنابراین می‌توانند باعث کاهش بیان ژن بیوفیلم wzm شوند. علت اینکه نانوذرات در برخی سویه‌ها کمتر بیان ژن را کاهش داده است نیز می‌تواند به میزان ورود نانوذره به درون سلول نقش داشته باشد.
Akhil و همکاران فعالیت ضد میکروبی و ضد بیوفیلمیِ نانوذره اکسید روی علیه استافیلوکوکوس اورئوس و سودوموناس آئروژینوزا را ارزیابی کردند. نتیجه پژوهش آن بود که این نانوذره، فعالیت ضد میکروبی و ضد بیوفیلمی چشمگیری داشت [21]. Jayaprakash نانوذرات اکسید روی را با استفادده از روش زیستی سنتز کردند و اثرات ضد باکتریایی و ضد بیوفیلمی‌آن را بررسی نمودند. نانوذرات این مطالعه توسط روش‌های FTIR، UV-Vis و SEM مورد تأیید قرار گرفتند. نتایج این مطالعه نانوذرات سنتز شده دارای ساختار کروی بوده و دارای اثرات ضدبیوفیلمی‌علیه پاتوژنهای میکروبی بودند [22]. Shakerimoghaddam و همکارانش اثرات ضد بیوفیلمی نانوذرات اکسید روی را بر روی سویه‌های یوروپاتوژنیک اشرشیا کلی و بیان ژن flu مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که نانو ذرات اکسید روی در غلظت زیرحد مهارکنندگی می‌توانند 50 درصد تولید بیوفیلم را کاهش بدهند [23]. RamachandranI  و همکارانش نانوذرات اکسید روی را با روش سنتز سبز با استفاده از عصاره Ulva lactuca سنتز نمودند و اثرات ضد بیوفیلمی‌آن را مورد مطالعه قرار دادند. نتایج اثرات ضدبیوفیلمی‌توسط روش میکروسکوپ لیزر کونفوکال نشان داد که این نانو ذره دارای اثرات ضد بیوفیلمی معناداری می­باشد (05/0p<) [24]. نقطه نظر مشابه تمامی این مطالعات با مطالعه ما اثرات معنادار ضد بیوفیلمی بود، به طوری که نانو ذرات با اندازه کوچک براحتی می‌توانند وارد ساختار نفوذ ناپذیز بیوفیلم شوند و با کاهش تعداد باکتری‌ها باعث کاهش تشکیل بیوفیلم شوند. اما یکی از اختلافات این مطالعات با مطالعه ما میزان کاهش تشکیل بیوفیلم می‌باشد که یکی از دلایل آن نوع بیوفیلم تشکیل شده توسط باکتری‌ها و سایز نانوذره سنتز شده و همچنین نوع ترکیبات فیتوشیمیایی موجود در سطح نانوذرات می‌باشد که می‌تواند اثرات متفاوتی بر روی تشکیل بیوفیلم داشته باشند [25].
یکی از محدودیت‌های این مطالعه بررسی اثرات ضد بیوفیلمی نانوذرات اکسید روی بر روی سایر پاتوژنهای بیمارستانی بود که پیشنهاد می‌شود اثرات ضدباکتریایی و ضد بیوفیلمی نانوذرات اکسید روی سنتز شده بر روی سایر پاتوژن‌ها بررسی شود تا بتوان اثرات ضد باکتریایی نانوذرات اکسید روی راحت تر اثبات نمود. همچنین پیشنهاد می‌شود اثرات این نانو ذره بر روی بیان سایر ژنهای ویرولانس نیز بررسی شود.     
نتیجه‌گیری
نتایج این مطالعه نشان داد که نانوذرات اکسید روی براحتی توسط عصاره گیاه لوئی (Typha latifolia) قابل سنتز است و این نانوذرات سنتز شده دارای اثرات معنادار ضدمیکروبی و ضد بیوفیلمی‌داشتند و می‌توانسنتد بیان ژن بیوفیلم wzm را در سویه‌های تشکیل دهنده کلبسیلا پنومونیه کاهش دهند. بنابراین می‌توان در آینده با مطالعات بیشتر مکانیسم دقیق اثرات ضد بیوفیلمی نانوذرات اکسید روی بر روی سویه‌های کلبسیلا پنومونیه شناسایی شود.
تشکر و قدردانی
این پژوهش برگرفته از پایان نامه دانشجویی کارشناسی اشد و با حمایت مالی معاونت پژوهشی دانشگاه آزاد اسلامی واحد تهران مرکزی بوده و نویسندگان مراتب قدردانی خود را از حمایت مالی معاونت پژوهشی دانشگاه اعلام مینمایند. از این جهت از تمامی‌ همکاران آزمایشگاه میکروب شناسی دانشگاه بابت هماهنگی بخش میکروب شناسی تقدیر و تشکر به عمل می‌آید.
 
 
 
 

 
References
 
 
 
[1] Jensen TS, Opstrup KV, Christiansen G, Rasmussen PV, Thomsen ME, Justesen DL, et l. Complement mediated Klebsiella pneumoniae capsule changes. Microbes Infect 2020; 22(1): 19-30.
[2] Cusumano JA, Caffrey AR, Daffinee KE, Luther MK, Lopes V, LaPlante KL.  Weak biofilm formation among carbapenem-resistant Klebsiella pneumoniae. Diagn Microbiol Infect Dis 2019; 95(1): 11-22.
[3] Doğan SŞ, Kocabaş A.  Green synthesis of ZnO nanoparticles with Veronica multifida and their anti-biofilm activity. Hum Exp Toxicol 2020; 39(1): 319-327.
[4] Golmohammadi M, Honarmand M, Ghanbari S.  A green approach to synthesis of ZnO nanoparticles using jujube fruit extract and their application in photocatalytic degradation of organic dyes. Spectrochim Acta A Mol Biomol Spectrosc 2020; 229(1): 117961-983.
[5] Typha latifolia, U.S. Forest service fire effects information database", U.S. Forest Service. Retrieved 2011-02-20.
[6] Hossain A, Abdallah Y, Ali MA, Masum MMI, Li B, Sun G, et al.  Lemon-fruit-based green synthesis of zinc oxide nanoparticles and titanium dioxide nanoparticles against soft rot bacterial pathogen Dickeya dadantii. Biomolecules 2019; 9(12): 863-75.
[7] Geetha K, Chellapandian M, Arulnathan N, Ramanathan A.  Nano zinc oxide - An alternate zinc supplement for livestock.  Vet World 2020; 13(1): 121-26.
[8] Tan D, Zhang Y, Cheng M, Le S, Gu J, Bao J, et al.  Characterization of Klebsiella pneumoniae ST11 isolates and their interactions with lytic phages. Viruses 2019; 11(11): 1080-89.
[9] Hsueh P-R, Ko W-C, Wu J-J, Lu J-J, Wang F-D, Wu H-Y, et al. Consensus statement on the adherence to clinical and laboratory standards institute (CLSI) antimicrobial susceptibility testing guidelines (CLSI-2010 and CLSI-2010-update) for Enterobacteriaceae in clinical microbiology laboratories in Taiwan. J Micro Immun Infect 2010;43(5): 452-5.
[10] Wang G, Zhao G, Chao X, Xie L, Wang H. The Characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumoniae. Int J Environ Res Public Health 2020; 17(17): 6278-84.
[11] Mohammad GRKS, Tabrizi MH, Ardalan T, Yadamani S, Safavi E. Green synthesis of zinc oxide nanoparticles and evaluation of anti-angiogenesis, anti-inflammatory and cytotoxicity properties. J Biosci 2019; 44(2): 30-9.
[12] Jayappa MD, Ramaiah CK, Kumar MAP, Suresh D, Prabhu A, Devasya RP, et al. Green synthesis of zinc oxide nanoparticles from the leaf, stem and in vitro grown callus of Mussaenda frondosa L.: characterization and their applications. Appl Nanosci 2020; 9:1-18.
[13] Krishna R, Ranjit TKAdhar CM. Size-dependent bacterial growth inhibition and mechanism of antibacterial activity of zinc oxide nanoparticles. Langmuir 2011; 27(1): 4020-8.
[14] Pillaia AM, Sivasankarapillai VS, Rahdar A. Green synthesis and characterization of zinc oxide nanoparticles with antibacterial and antifungal activity. J Mol Str 2020; 1211(1): 128107-122.
[15] Minha NUsman ABushra KBin C. Green route to synthesize Zinc Oxide Nanoparticles using leaf extracts of Cassia fistula and Melia azadarach and their antibacterial potential. Sci Rep 2020; 10(1): 9055-63.
[16] Pomastowski P, Król-Górniak A, Railean-Plugaru V, Buszewski B. Zinc oxide nanocomposites-extracellular synthesis, physicochemical characterization and antibacterial potential. Materials (Basel) 2020; 13(19): E4347-55.
[17] Zarea E, Pourseyedia Sh, Khatami M, Darezereshki E. Simple biosynthesis of zinc oxide nanoparticles using nature's source, and it's in vitro bio-activity. J Mol Struct 2017; 1146(15): 96-103.
[18] Buşilă M, Tăbăcaru A, Muşsat V, Vasile BŞ, Neaşu IA, Pinheiro T, Roma-Rodrigues C, Baptista PV, Fernandes AR, Matos AP, Marques F. Size-Dependent Biological Activities of Fluorescent Organosilane-Modified Zinc Oxide Nanoparticles. J Biomed Nanotechnol 2020; 16(2): 137-52.
[19] Chen P, Wang H, He M, Chen B, Yang B, Hu B. Size-dependent cytotoxicity study of ZnO nanoparticles in HepG2 cells. Ecotoxicol Environ Saf 2019; 171: 337-46.
[20] Raghupathi KR, Koodali RT, Manna AC. Size-dependent bacterial growth inhibition and mechanism of antibacterial activity of zinc oxide nanoparticles. Langmuir 20115; 27(7): 4020-8.
[21] Ifeanyichukwu UL, Fayemi OE, Ateba CN. Green synthesis of zinc oxide nanoparticles from Pomegranate [Punica granatum] extracts and characterization of their antibacterial activity. Molecules 2020; 25(1): E4521-33.
[22] Jayaprakash J, Ganesh M, Nandhini K. Green biogenic synthesis of zinc oxide nanoparticles using Pseudomonas putida culture and it’s In vitro antibacterial and anti-biofilm activity. Biocatalysis and Agricultural Biotechnology 2019; 2(5): 101327-36.
[23] Shakerimoghaddam A, Ghaemi EA, Jamalli A. Zinc oxide nanoparticle reduced biofilm formation and antigen 43 expressions in uropathogenic Escherichia coli. Iran J Basic Med Sci 2017; 20(1): 451–6.
[24] Ramachandran I, Baskaralingam V, Subramanian K. Facile green synthesis of zinc oxide nanoparticles using Ulva lactuca seaweed extract and evaluation of their photocatalytic, anti-biofilm and insecticidal activity. J Photochem Photobiol B 2018; 178(1): 249-58.
[25] Preedia Babu E, Subastri A, Suyavaran A, Premkumar K, Sujatha V, Aristatile B, et al. Size dependent uptake and hemolytic effect of zinc oxide nanoparticles on erythrocytes and biomedical potential of ZnO-Ferulic acid conjugates. Sci Rep 2017; 7(1): 4203.


 
Anti-biofilm Effects of Zinc Oxide Nanoparticles Synthesized by Leaf Extract of Typha Latifolia on Biofilm Gene Expression in Multidrug-Resistant Klebsiella Pneumoniae Strains: A Laboratory Study
 
 
N. Kalhor[4], A. Mirzaie[5], S. M. M. Hamdi[6]
 
 
Received:20/10/2020   Sent for Revision: 16/12/2020 Received Revised Manuscript:07/03/21 Accepted: 08/03/21
 
 
Background and Objectives: Biofilms are a community of bacteria on surfaces coated with extracellular polymeric materials, and one strategy to remove biofilms is to use nanoparticles. The aim of this study was to synthesize green zinc oxide (ZnO) nanoparticles and determine its anti-biofilm effects on biofilm gene expression in multidrug-resistant Klebsiella pneumoniae strains.
Materials and Methods: In this in vitro study, ZnO nanoparticles were synthesized by green method using zinc nitrate solution and Typha latifolia extract. Its physical and chemical properties were confirmed by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and FTIR (Fourier-transform infrared spectroscopy) methods. Its antimicrobial and anti-biofilm effects against multidrug-resistant Klebsiella pneumoniae isolates were investigated using minimum inhibitory concentration and plate microtiter methods, respectively. Finally, the effects of ZnO nanoparticles on the expression of wzm biofilm gene were investigated using Real Time PCR.
Results: The synthesized ZnO nanoparticles had a spherical morphology and had a size of less than 100 nm. The results also showed that the synthesized ZnO nanoparticles had significant antimicrobial and anti-biofilm effects against multidrug-resistant K. pneumoniae strains and these nanoparticles significantly reduced the expression of wzm biofilm gene (p<0.05).
Conclusion: The findings of this study showed that the synthesized ZnO nanoparticles have significant antimicrobial and anti-biofilm effects and in the future, with further studies, these nanoparticles can be used as an anti-biofilm candidate.
Key words: Zinc oxide nanoparticles, Klebsiella pneumoniae, Antimicrobial, Anti-biofilm, Biofilm gene expression
 
Funding: This study was funded by Islamic Azad University, Central Tehran Branch as a research project.
Conflict of interest: None declared
Ethical approval: The Ethics Committee of the Islamic Azad University, Central Tehran Branch has approved the study design (IAU.AC.IR 22310).
 
How to cite this article: Kalhor N, Mirzaie A, Hamdi S M M. Anti-biofilm Effects of Zinc Oxide Nanoparticles Synthesized by Leaf Extract of Typha Latifolia on Biofilm Gene Expression in Multidrug-Resistant Klebsiella Pneumoniae Strains: A Laboratory Study. J Rafsanjan Univ Med Sci 2021; 20 (1): 3-22. [Farsi]


 
[1]- کارشناسی ارشد، گروه زیست شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران
[2]- (نویسنده مسئول) استادیار، گروه زیست شناسی، واحد پرند، دانشگاه آزاد اسلامی، پرند، ایران
تلفن: 56733001-021، دورنگار: 56733001-021، پست الکترونیکی: Amir_mirzaie92@yahoo.com
[3]- دانشیار، گروه زیست شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران
 
  1. - MSc, Dept. of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran, ORCID: 0000-0002-06584-6624
[5]- Assistance Prof., Dept. of Biology, Parand Branch, Islamic Azad University, Parand, Iran, ORCID: 0000-0002-0941-7828
(Corresponding Author) Tel: (021) 56733001, Fax: (021) 56733001, E-Mail: Amir_mirzaie92@yahoo.com
[6]- Associated Prof., Dept. of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran, ORCID: 0000-0002-6528-6849
نوع مطالعه: پژوهشي | موضوع مقاله: ميكروبيولوژي
دریافت: 1399/7/25 | پذیرش: 1399/12/18 | انتشار: 1400/2/1

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2024 CC BY-NC 4.0 | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb