جلد 20، شماره 1 - ( 1-1400 )                   جلد 20 شماره 1 صفحات 52-37 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Darvishzadeh N, Azizbeigi K, Etemad Z. The Effect of Aerobic Exercises and Octopamine Consumption on Changes in Gene Expression of Caspase-9, NLRP3, AIM2 in Brown Adipose Tissue of Rats after Intoxication with Deep Fried Oil: An Experimental Study. JRUMS 2021; 20 (1) :37-52
URL: http://journal.rums.ac.ir/article-1-5775-fa.html
درویش زاده ناهید، عزیزبیگی کمال، اعتماد ظاهر. تأثیر تمرینات هوازی و مصرف اکتاپامین بر تغییرات بیان ژن کاسپاز9، nlrp3، aim2 بافت چربی قهوه‌ای موش‌های صحرایی پس از مسمومیت با روغنهای حرارت دیده عمیق: یک مطالعه تجربی. مجله دانشگاه علوم پزشکی رفسنجان. 1400; 20 (1) :37-52

URL: http://journal.rums.ac.ir/article-1-5775-fa.html


دانشگاه آزاد اسلامی
متن کامل [PDF 622 kb]   (665 دریافت)     |   چکیده (HTML)  (1403 مشاهده)
متن کامل:   (1257 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 20، فروردین 1400، 52-37
 
تأثیر تمرینات هوازی و مصرف اکتاپامین بر تغییرات بیان ژن کاسپاز9، nlrp3، aim2 بافت چربی قهوه­ای موش­های صحرایی پس از مسمومیت با روغنهای حرارت دیده عمیق: یک مطالعه تجربی
 
ناهید [j1] درویش‌‌زاده[1]، کمال عزیزبیگی[2]، ظاهر اعتماد[3]
 
دریافت مقاله:22/10/99  ارسال مقاله به نویسنده جهت اصلاح:13/11/99   دریافت اصلاحیه از نویسنده:10/12/99        پذیرش مقاله: 13/12/99
 
 
 

چکیده
زمینه و هدف: انجام تمرینات هوازی در کنار مصرف مکمل­های گیاهی قادر به کنترل التهاب می­باشد. هدف از مطالعه حاضر تعیین تأثیر تمرینات هوازی و مصرف اکتاپامین بر تغییرات ژنNLR family pyrin domain containing 3 (nlrp3) ، absent in melanoma 2 (aim2) و کاسپاز 9 بافت چربی قهوه­ای در موش­های صحرایی پس از  مصرف روغن حرارت دیده عمیق بود.
مواد و روش­ها: مطالعه حاضر از نوع تجربی بود. 40 سر موش صحرایی نر نژاد ویستار به طور تصادفی در گروه­های 8 تایی شامل: کنترل سالم، کنترل مسموم با روغن حرارت دیده، مسموم+تمرین هوازی، مسموم+اکتاپامین و مسموم+تمرین هوازی+اکتاپامین قرار داده شدند. روغن حرارت دیده به مدت 4 هفته به موش­های صحرایی خورانده شد. دوز مورد استفاده اکتاپامین 81 میکرومول/کیلوگرم بود. گروه­های تمرینات هوازی به مدت چهار هفته بر روی نوارگردان با شدت فزآینده تمرین کردند. جهت تعیین تغییرات ژن­هایnlrp3، aim2، کاسپاز 9 و هم­چنین تغییرات بیان پروتئینی NLRP3 به ترتیب روش­های Real time PCR و IHC به­کار گرفته شدند. برای آنالیز داده‌ها از آنالیز واریانس دوطرفه استفاده شد.
یافته­ها: تمرین هوازی موجب کاهش معنی­داری در بیان ژن nlrp3 (010/0=p) و aim2 (001/0=p) نسبت به گروه کنترل مسموم شد. دریافت مکمل اکتاپامین نیز کاهش معنی­دار بیان ژن  nlrp3 (009/0=p) و aim2 (001/0=p) را به همراه داشت. تعامل ورزش و تمرین هوازی سبب کاهش معنی­دار پروتئین NLRP3 شد (001/0=p).
نتیجه­گیری: اعمال 4 هفته تمرین ورزشی و یا مصرف اکتاپامین به صورت مجزا با کنترل کمپلکس اینفلامازوم، مرگ سلولی در بافت چرب قهوه­ای را کاهش می­دهد که در قهوه­ای و کارآمدتر شدن بافت چربی مؤثر می­باشد.
واژه­های کلیدی: آپوپتوز،NLRP3 ، AIM2، چربی قهوه­ای، تمرینات هوازی، اکتاپامین، روغن حرارت دیده
 
 
 
 
 
 
 
 
 
 
 
مقدمه
سرخ کردن غذاها یک فرآیند رایج و گسترده در آشپزی است، که به دلیل فروش قابل توجه و فراوان محصولات سرخ شده، اغلب در صنایع غذایی مورد استفاده قرار می­گیرد [1]. طی سرخ کردن مقداری قابل توجهی چربی­های مضر وارد بافت ماده غذایی خواهد شد. افزایش مصرف غذای پرچرب، صرفه نظر از افزایش کالری دریافتی، می­تواند در القاء دیابت و بیماری­های التهابی از طریق فاکتورهای التهابی مختلف مؤثر باشد [2]. انواع بافت چربی در بدن شامل بافت چربی سفید، قهوه­ای و بژ می­باشد که هر کدام از این بافت­ها می‌تواند تأثیرات متفاوتی داشته باشند و در القاء التهاب نقش به سزایی داشته باشند [3]. در نمونه­های حیوانی نشان داده شده که سلول­های چربی در حیوانات چاق اختلال در عملکرد اندامکها از جمله استرس شبکه آندوپلاسمی [4]، اختلال عملکرد میتوکندری [5] و فعال شدن مسیر التهابی اینفلامازوم NLRP3 (NLR family pyrin domain containing 3) همراه بوده که این علائم حاکی از این است که سلول­های چربی تحت فشار هیپرتروفیک دچار مرگ سلولی پیروپتوزی میشوند و پاسخ التهابی را شروع می­کنند [6].
اینفلامازوم کمپلکس چند پروتئینی هستند که در پاسخ به عفونت، آسیب سلول یا استرس محیطی فعال می­شوند که منجر به استخدام و فعال سازی کاسپازها و مرگ سلولی میشوند [7]. کاسپازهای پیش برنده آپوپتوز شامل کاسپازهای آغازگر 2، 8 و 9 بوده که نهایتاً کاسپازهای 3 و 7 را فعال خواهند کرد. کاسپاز۹ یک پروتئاز مختص ‌به اسید آسپارتیک بوده که فرایند آپوپتوز را فعال کرده و  به متلاشی شدن DNA ختم می­شود. DNA درون سیتوزول منجر به تشکیل absent in melanoma 2 (AIM2) می­شود [8]. AIM2 نیز، یک کمپلکس التهابی یعنی پروتئین NLRP3 را فعال می­کند [9]. AIM2 و NLRP3 دارای دامنه پیرین بوده و برای تشکیل التهاب،apoptosis-associated specklike protein containing a CARD (ASC) و کاسپازها را استخدام می­کند. در هر حال تمام این مسیرهای اینفلامازومی با مرگ سلولی مرتبط هستند [7]. امروز مدالیته­های درمانی متنوعی برای کنترل مسیرهای سلولی در نظر گرفته شده که از جمله کم خطرترین و ارزان­ترین آن­ها مصرف مکمل­های مختلف نظیر گیاهی و هم­چنین انجام تمرین ورزشی منظم می­باشد [10].
عصاره میوه نارنج (Citrus aurantium)، به طور سنتی به عنوان محصولات کاهش وزن و مهار کننده­های اشتها استفاده می­شود [11]. جزء اصلی این عصاره­ها، اکتاپامین است که یک ماده آدرنرژیک می­باشد [12]. از لحاظ متابولیکی بیان شده که اکتاپامین باعث افزایش گلیکوژنولیز، گلیکولیز، جذب اکسیژن و گلوکونئوژنز می­شود [11]. اکتاپامین اکسیداسیون اسیدهای چرب برون­زا (اکتانوات و اولئات) را تسریع می­بخشد [13]. از طرفی دیگر انجام تمرینات ورزشی نیز خود به صورت مجزا می­تواند تأثیرات منفی بافت چرب را خنثی و هم­چنین بافت چربی قهوه­ای را کارآمدتر سازد [14]. شواهد جدید نشان می­دهد که ورزش منجر به سازگاری عمده­ای در بافت چربی به ویژه قهوه­ای کردن چربی سفید و کارآمدی بافت چربی قهوه­ای می­شود [14]، که در تأثیرات متابولیکی ورزش بر سلامتی نقش دارد.
بر اساس جستجوهای انجام شده، تاکنون هیچ مطالعه­ای نقش اکتاپامین (از نارنج) با ورزش بر بافت چرب را ارزیابی نکرده است، لذا هدف از مطالعه حاضر تعیین تأثیر تمرین هوازی و مصرف اکتاپامین بر انفلامازوم nlrp3، aim2 و آپوپتوزیس بافت چربی قهوه­ای در موش­های صحرایی پس از مصرف روغن حرارت دیده عمیق می­باشد.
مواد و روش­ها
مطالعه حاضر از نوع تجربی بود. 40 سر موش صحرایی نژاد ویستار (سن 20 هفته، وزن 20±250 گرم) از انستیتو پاستور ایران تهیه و پس از انتقال موش­ها به محیط جدید (آزمایشگاه هیستوژنوتک، تهران، ایران، بهار 1399)، حیوانات در شرایط کنترل شده با 12 ساعت روشنایی و 12 ساعت تاریکی (شروع روشنایی 6 صبح و شروع خاموشی 6 عصر)، دما (3±22 سانتی­گراد)، و رطوبت حدود 45 درصد نگه­داری شدند. تعداد 5-3 موش صحرایی در قفس­هایی از جنس پلکسی گلاس با درب توری و به ابعاد 25 در 27 در 43 سانتی­متر به گونه­ای نگه­داری شدند که تمامی حیوانات به آب و غذای استاندارد دسترسی آزاد داشتند. حیوانات پس از یک هفته آشناسازی با محیط آزمایشگاه به طور تصادفی در گروههای کنترل سالم (8=n)، کنترل مسموم (مسمومیت با روغن حرارت دیده عمیق) (8=n)، مسموم + تمرین هوازی (8=nمسموم + اکتاپامین (8=nمسموم + تمرین هوازی + اکتاپامین  (8=n) قرار داده شدند. القاء مسمومیت با استفاده از مصرف روغن حرارت دیده عمیق به صورت خوراکی انجام شد [15]. لازم به ذکر است تمامی مراحل پژوهش توسط کمیته اخلاقی حیوانات دانشگاه علوم پزشکی کردستان (مطابق با استانداردهای National Institutes of Health; NIH)) مطالعه شد و با تأییدیه کد اخلاق IR.MUK.REC.1398.242 مورد تصویت قرار گرفت.
به منظور تهیه روغن حرارت دیده بر اساس مطالعات پیشین از 8 لیتر روغن آفتاب گردان مخصوص سرخ کردن استفاده شد. روغن به مدت چهار روز متوالی روزی هشت ساعت با حرارت 200-190 درجه سانتی­گراد داغ شده و هر 30 دقیقه مواد غذایی ناگت مرغ، سیب زمینی، مرغ و فرآورده­های پروتئینی سوسیس و کالباس داخل روغن غوطهور شده و در انتها روغن روز چهارم به منظور استفاده به عنوان مداخله مسمومیتی تا زمان اجرا نگه­داری و به صورت خوراکی (گاواژ) به مدت 4 هفته به موش­های صحرایی خورانده شد [16].
موش­های گروه مسموم + اکتاپامین و هم­چنین مسموم + تمرین هوازی + اکتاپامین، مکمل اکتاپامین (سیگما آلدریچ) با دوز 81 میکرومول/کیلوگرم به مدت چهار هفته، پنج روز در هفته تجویز شد. این مکمل به صورت تزریق درون صفاقی و حل شده با نرمال سالین 9 درصد مشابه تحقیقات گذشته (با این تفاوت که بافت چربی مورد تجزیه تحلیل قرار گرفت) اعمال شد [15].
برنامه تمرینی به مدت چهار هفته و با شدت متوسط بر روی نوارگردان حیوانی برای موش­های صحرایی در گروههای مسموم + تمرین هوازی و مسموم + تمرین هوازی + اکتاپامین انجام پذیرفت. شدت تمرین در هفته اول 50 درصد vo2max و در هفته آخر به 65 درصد vo2max رسید. به منظور سازگاری تمرینی، موش­ها قبل از شروع برنامه اصلی تمرینی یک هفته تمرین سازگاری با سرعت 9 متر بر دقیقه، به مدت 20 دقیقه انجام دادند. مدت زمان تمرین بر اساس 20 دقیقه ثابت بوده و شدت تمرین از روز اول 16 متر بر دقیقه و در روز آخر به 26 متر بر دقیقه رسید. برای شروع تمرین 5 دقیقه با سرعت 7 متر بر دقیقه گرم کردن و پس از تمرین اصلی 5 دقیقه با سرعت 5 متر بر دقیقه سرد کردن در نظر گرفته شد. لازم به ذکر است در طول برنامه تمرینی از هیچ­گونه شوک تمرینی استفاده نشد و در صورت لزوم با استفاده از دست و یا ایجاد محرک صوتی بر روی درپوش ریل­های نوارگردان، حیوانات مجبور به ادامه تمرین شدند [17].
در پایــان هفتــه چهــارم از پروتکــل تمرینــی و مصرف مکمل اکتاپامین (48 ساعت بعد از آخرین جلسه تمرینی)، موش­ها با تزریق اکتامین (70 میلی گرم/کیلوگرم) و زایلارین (10 میلی­گرم/کیلوگرم) بی­هوش شدند و سپس بافت چربی قهوه­ای موش­ها از ناحیه کتف به طول دو سانتی­متر قطع گردید و در پارافرمالدهیـد 4 درصد به مدت یک شبانه روز در دمـای 4 درجـه سـانتی­گـراد قرار داده شد. بعد از گذشت 24 ساعت از مرحلـه تثبیـت اولیـه، برش 5 میکرومتری از ناحیه بافت چربی قهوه­ای تهیه و رنگ آمیـزی H&E برای ارزیابیهای بافتی انجام شد [18]. ارزیابی کیفی تصاویر توسط پاتولوژیست انجام شد.
جهت بررسی­های مولکولی در سطح بیان ژن، ابتدا استخراج RNA از بافت­ها در همه گروه­های مورد بررسی، طبق پروتکل شرکت سازنده (کیاژن، آلمان) انجام گرفت. برای این کار، میزان 200 لاندا کیازول به نمونه­ها اضافه شد و به مدت 24 ساعت در دمای 80- انکوبه (مدلICO50T2K6T6، Memmert، آلمان) شد. پلاک موجود در کرایوتیوب در حالت نیمه انجماد خرد شد و به منظور لیز نمونه­ها میزان 100 لاندا کلروفرم به مدت 1 دقیقه به آنها اضافه شد. محلول حاصل، با دور 12000 به مدت 10 دقیقه سانتریفیوژ (مدل Centric322، دامل، آمریکا) گردید. مایع شفاف قسمت بالایی لوله که حاوی RNA بود به آرامی برداشته و در یک میکروتیوب DEPC شده قرار داده شد. 1 میلی لیتر ایزوپروپانول بر رویRNA  شفاف ریخته شد و به مدت 1 دقیقه با دست به هم زده شد. نمونه­ها در سانتریفیوژ با دور 12000 به مدت 10 دقیقه قرار داده شد. سپس مایع رویی دور ریخته شد و روی رسوب آن 1 میلی لیتر الکل 70 درصد اضافه گردید. پس از Vortex کردن، مخلوط در سانتریفیوژ به مدت 10 دقیقه با دور 7500 قرار گرفت. مایع رویی تخلیه گردید و پلاک در داخل میکروتیوب خشک شد. میزان 20 لاندا آب مقطر 60 درجه بر روی پلاک ریخته شد و به مدت 5 دقیقه بر روی صفحه 60 درجه قرار داده شد. پس از استخراج RNA با خلوص و غلظت بالا از تمامی نمونه­های مورد مطالعه، مراحل سنتز cDNA طبق پروتکل شرکت سازنده (Fermentas, USA) انجام گرفت و سپس cDNA سنتز شده جهت انجام واکنش رونویسی معکوس مورد استفاده قرار گرفت. اندازه‌گیری سطوح بیان nlrp3، aim2 و کاسپاز 9 از روش کمیReal time-PCR  انجام شد. طراحی پرایمرها بر اساس اطلاعات ژن­های nlrp3، aim2، کاسپاز9 و GAPDH در بانک ژنی NCBI و توسط شرکت ماکروژن انجام شد. از ژن گلیسرآلدهید-3-فسفات دهیدروژناز(GAPDH)  به عنوان ژن کنترل استفاده گردید و میزان بیان ژن مورد نظر با فرمول -ΔΔCT  2 ­به روش زیر محاسبه شد [19].
به این صورت که ابتدا سیکل آستانه ژن مورد نظر هر نمونه را از سیکل آستانه ژن خانه­گردان همان نمونه کم شد.
(∆Ct= Ct Target-Ct Housekeeping)
در مرحله بعد، عدد به­دست آمده از دلتا Ct هر نمونه را از نمونه­ای که نسبت به آن نیاز بود مقایسه شود کم کرده، منفی عدد به دست آمده را به توان دو رسانده و بیان نسبی ژن NLRP1را به دست می­آوریم [20].
(∆∆Ct=∆Ct Target-∆Ct Reference) ∆∆Ct- E= 2
توالی پرایمرهای مورد استفاده در جدول 1 زیر گزارش شده است.
 
 
جدول 1- توالی پرایمرها مورد استفاده برای Real time PCR
GAPDH F AAGTTCAACGGCACAGTCAAGG
GAPDH R CATACTCAGCACCAGCATCACC
Caspase9 R CAG GAG ACA AAA CCT GGG AA
Caspase9 F AGC CAG ATG CTG TCC CAT AC
Aim2 F TGATGAGTTGGGCATGGGATGGT
Aim2 R TAAAGGGTGGGGGTGGCAAGA
Nlrp3 F GGAGTGGATAGGTTTGCTGG 
Nlrp3 R GGTGTAGGGTCTGTTGAGGT 
 
 
حیوانات پس از طی زمان مذکور (4 هفته) و تزریق درون صفاقی کتامین و زایلارین بی­هوش شده و قسمتی از بافت چرب قهوه­ای آن­ها بلافاصله استخراج و در فرمالین 10 درصد  قرار داده شد. پس از تثبیت نمونه­ها، بافت­های قالب‌گیری شده در پارافین توسط دستگاه میکروتوم (مدل KD-3390، چین) برش­هایی با ضخامت 5 میکرومتر گرفته شد. برش­های به دست آمده به منظور بازیابی آنتی‌ژنی، در بافر TBS1X (2/9=pH) به مدت 20 دقیقه در دمای 70 درجه سانتی­گراد انکوبه شد. سپس تریتون 3/0 درصد به مدت 30 دقیقه به منظور نفوذپذیر کردن غشاء سلول­ها استفاده گردید پس از شست و شو با PBS، سرم بز 10 درصد برای مدت 30 دقیقه به منظور بلوک کردن واکنش آنتی‌بادی ثانویه به صورت رنگ اضافی زمینه اضافه شد. آنتی‌بادی اولیه (NBP2-12446SS، آمریکا) رقیق شده ضد NLRP3 (1 به 100) با PBS به مدت یک شب به نمونه اضافه گردید و در دمای 2 تا 8 درجه انکوبه شد. پس از شست و شو با PBS آنتی‌بادی ثانویه متصل شده با رنگ FITC اضافه شد و در دمای 37 درجه سانتی­گراد به مدت 2 ساعت در تاریکی انکوبه گردید. در نهایت به منظور رنگ‌آمیزی هسته، به نمونه ها DAPI اضافه شد. در مرحله آخر نمونه توسط میکروسکوپ فلوروسنت (مدل Olympus، آلمان) با لنز 400 برای تأیید مارکرها مشاهده شدند [21]. برای کمی کردن تصاویر نیز از نرم افزار Image J استفاده شد.
در این تحقیـق بـرای رسـم نمودارهـا از نرم‌افـزار اکسل (مایکروسافت آفیس 2013) اسـتفاده شـده اسـت. در همـه نمودارهـا، داده­هـا بـه صـورت انحراف استاندارد ± میـانگین گزارش شده اسـت. آنـالیز آمـاری داده­ها بـه وسیله نرم‌افزار SPSS  نسخه 22 انجام شد. قبل از تجزیه و تحلیل دادهها آزمون طبیعی بودن توزیع داده­ها با استفاده از آزمون شاپیروویلک و همگنی واریانس با استفاده از آزمون لون مورد بررسی قرار گرفت. بر اساس سطح معناداری مشاهده شده توزیع دادها برای بیان ژنNLRP3 (077/0=pAIM3 (200/0=p)، کاسپاز 9 (169/0=p)  و بیان پروتئین NLRP3 (065/0=p) همگی از 05/0 بزرگ­تر بوده و طبیعی بودن توزیع دادها مورد تأیید قرار گرفت. همچنین نتایج آزمون لون نیز نشان داد سطح معنی­داری بـرای بیان ژن NLRP3 (142/0=pAIM3 (156/0=p)، کاسپاز 9 (114/0=p) و بیان پروتئین NLRP3 (731/0=p) نیز بزرگ­تر از 05/0 بوده لذا همگنی واریانس­ها نیز مورد تأیید قرار گرفت. با توجه به تأیید طبیعی بودن توزیع داده­ها و همگنی واریانس­ها، جهت مقایسـه اثر تمرین و مکمل اکتاپامین بر متغیرهای پژوهش از آنالیز واریانس دوطرفه استفاده شد و به دنبال آن برای مقایسه چندگانه از آزمون Bonferroni استفاده گردید. هم‌چنین از مجذور اتا (ƞ) برای نشان دادن اندازه اثر برای آزمون تحلیل واریانس دوطرفه استفاده شد. سطح معنی­داری در آزمون­ها 05/0 در نظر گرفته شد. برای کمی کردن تصاویر نیز از نرم‌افزار Image J استفاده شد.
نتایج
بر اساس نتایج به­دست آمده از تصاویر بافتی رنگ آمیزی شده با H&E، مشخص شد که در گروه کنترل مسموم تعداد بیشتری از سلول­های بافت چربی سفید جایگزین سلول­های چربی قهوه­ای شده است (شکل 1). تغییرات هیستولوژیک بافت چربی قهوه­ای را نشان می­دهد. همان­طور که مشاهده می­شود سلول­ها حاوی قطرات چربی با اندازه­های مختلف میباشند. در این تصاویر سلول­های چربی قهوه­ای با هسته‌های گرد و اغلب مرکزی نشان داده شده است. بسیاری از سلول­ها به صورت چندوجهی و کاملاً فشرده و حاوی قطرات متعدد چربی هستند در برخی سلول­ها، قطرات چربی بزرگ و هستهها را به سمت حاشیه سلول جا به جا می­کند. شبکه­ای از الیاف کلاژن و مویرگ­ها نیز سلول­های چربی قهوه­ای را احاطه میکند.
هم­چنین بر اساس این نتایج میزان جمعیت سلول­های چربی سفید در گروه­های مسموم + تمرین هوازی و مسموم + اکتاپامین نسبت به گروه کنترل مسموم کاهش قابل توجه داشته است. این در حالی بود که این دو گروه نسبت به گروه کنترل سالم جمعیت سلولی چربی قهوه­ای کمتری دارند. در گروه مسموم + تمرین هوازی + اکتاپامین نیز جمعیت سلولهای چربی قهوه­ای زیاد بوده و نسبت به گروه کنترل نرمال تفاوت قابل توجهی را نشان نداد.
 
 

 
 
 
 
 
 
 
شکل 1- تغییرات بافت چربی قهوه­ای به دنبال تمرین ورزشی و مکمل اکتاپامین در موش­های مسموم شده با روغن حرارت دیده عمیق (تصاویر H&E با بزرگنمایی 200um). گروه DFO بیشترین نفوذ سلول­های چربی سفید را نشان می­دهد که گروه DFO مصرف کننده مکمل و تمرین ورزشی بیشترین مهار نفوذ چربی سفید را دارد. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
 
 
تغییرات بیان ژنی nlrp3 در نمودار 1 نشان داده شده است بر اساس این نتایج، در اثر مسمومیت با روغن حرارت دیده عمیق بیان ژنNLRP-3  به طور معنی­داری افزایش یافت  (001/0=p) (نمودار 1). در مقابل تمرین کاهش معنی­داری بر بیان ژن nlrp3 داشت (285/0= ƞو 010/0=p  و 991/7=F). دریافت مکمل اکتاپامین نیز موجب کاهش معنی­داری بر بیان ژن nlrp3 شد (297/0= ƞو 009/0=p و 460/8=F)، با وجودی که کمترین میزان بیان ژن nlrp3 مربوط به گروه تمرین و مکمل اکتاپامین بود، ولی اثر متقابل تمرین و اکتاپامین از نظر آماری معنی­دار نبود (001/0= ƞو 986/0=p  و 001/0=F) (نمودار 1).

نمودار 1- مقایسه  بیان ژن nlrp3 در گروه­های سالم و مسموم شده با روغن حرارت دیده عمیق. اطلاعات بر اساس میانگین و انحراف استاندارد گزارش شده است. *نشانه افزایش معنی­داری نسبت به گروه کنترل سالم. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
تغییرات بیان ژنی aim2 در نمودار 2 نشان داده شده است بر اساس این نتایج، در اثر مسمومیت با روغن حرارت دیده عمیق بیان ژن aim2 به طور معنی­داری افزایش یافت (001/0=p) (نمودار 2). تمرین موجب کاهش معنی­داری بر بیان ژن aim2 شد (424/0= ƞو 001/0=p  و 743/14=F). دریافت مکمل اکتاپامین نیز کاهش معنی­دار بیان ژن aim2 را به همراه داشت (441/0= ƞ و 001/0=p  و 757/15=F). با وجودی که کمترین میزان بیان ژن aim2 مربوط به گروه تمرین و مکمل اکتاپامین بود، ولی اثر متقابل تمرین و اکتاپامین از نظر آماری معنی­دار نبود (036/0= ƞو 392/0=p  و 755/0=F) (نمودار 2).  

نمودار 2- مقایسه بیان ژن aim2 در گروه­های سالم و مسموم شده با روغن حرارت دیده عمیق (الف و ب). اطلاعات بر اساس میانگین و انحراف استاندارد گزارش شده است. *نشانه افزایش معنی‌داری نسبت به گروه کنترل سالم. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
تغییرات بیان ژنی کاسپاز 9 در نمودار 3 نشان داده شده است. بر اساس این نتایج، در اثر مسمومیت با روغن حرارت دیده عمیق  بیان ژن کاسپاز 9 به طور معنیداری افزایش یافت (001/0=p) (نمودار 3). تمرین موجب کاهش معنی‌داری در بیان ژن کاسپاز 9 شد (347/0= ƞو 004/0=p و 606/10=F). دریافت مکمل اکتاپامین نیز موجب کاهش معنی­داری بر  بیان ژن کاسپاز 9  شد (325/0= ƞو 006/0=p  و 633/9=F). با وجودی که کمترین میزان بیان ژن کاسپاز 9 مربوط به گروه تمرین و مکمل اکتاپامین بود، ولی اثر متقابل تمرین و اکتاپامین از نظر آماری معنیدار نبود (001/0= ƞو 000/1=p  و 001/0=F) (نمودار 3).

نمودار 3- مقایسه بیان ژن کاسپاز 9 در گروه­های سالم و مسموم شده با روغن حرارت دیده عمیق. اطلاعات بر اساس میانگین و انحراف استاندارد گزارش شده است. *نشانه افزایش معنی­داری نسبت به گروه کنترل سالم. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
تغییرات بیان پروتئینی NLRP-3 در شکل 2 و نمودار 4 نشان داده شده است، بر اساس این نتایج، در اثر مسمومیت با روغن حرارت دیده عمیق  بیان پروتئین NLRP-3 به طور معنی­داری افزایش یافت (001/0=p). تمرین موجب کاهش معنی­داری بر بیان پروتئین NLRP-3 شد (919/0= ƞو 001/0=p  و 85/227=F). دریافت مکمل اکتاپامین نیز کاهش معنی­داری بر بیان پروتئین NLRP-3 را به همراه داشت (923/0= ƞو 001/0=p  و 01/239=F). اثر متقابل تمرین و مکمل اکتاپامین نیز بر بیان پروتئین NLRP-3 معنی­دار بود و کاهش معنی­داری در پروتئین NLRP3 ایجاد کرد (348/0= ƞ و 002/0=p  و 440/12=F).  (شکل 2 و نمودار 4).
 
الف)

 
 
 
 
 
شکل 2- تغییرات بیان پروتئین NLRP3 در گروه­های سالم و مسموم شده با روغن حرارت دیده عمیق با روش IHC (بزرگنمایی 20um). گروه DFO بیشترین بیان پروتئین NLRP3 را نشان می­دهد. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
 

نمودار4- مقایسه بیان پروتئین NLRP3 در گروه­های سالم و مسموم شده با روغن حرارت دیده عمیق. اطلاعات بر اساس میانگین و انحراف استاندارد گزارش شده است. *نشانه افزایش معنی­داری نسبت به گروه کنترل سالم. Control: گروه کنترل سالم، DFO: گروه مسموم شده با روغن سوخته، روغن حرارت دیده عمیق + EXE: گروه مسموم روغن حرارت دیده عمیق + تمرین ورزشی، DFO+OCT: گروه مسموم DFO+ اکتاپامین، DFO+EXE+OCT: گروه مسموم DFO+ تمرین ورزشی+ اکتاپامین.
بحث
نتایج مطالعه حاضر نشان داد که مصرف روغن حرارت دیده با تغییرات افزایشی اینفلامازوم­های nlrp3، aim2 و کاسپاز9 بافت چرب قهوه­ای همراه بود که این تغییرات با تخریبات بافت چربی و سفید شدن آن نیز ارتباط داشت. چندین مطالعه نشان می­دهد که محصولات تولید شده از طریق اکسیداسیون روغن می­توانند منجر به تخریب ساختاری روغن و سرطان­زا باشند [22]. سرخ شدن طولانی باعث افزایش قابل توجه غلظت مالون­دی­آلدهید (Malondialdehyde; MDA) می­شود. MDA در حین سرخ کردن کنترل نمی­شود. مشخص شد که MDA باعث ایجاد سرطان در موش­های صحرایی می­شود و باعث ایجاد ارتباط متقابل با گروه­های آمینه محلول Deoxyribonucleic acid (DNA) می­شود [23]. به نظر میرسد در مطالعه حاضر نیز افزایش MDA و شاخص­های اکسایشی در افزایش فاکتورهای اینفلامازوم مطالعه حاضر نیز مؤثر بوده باشد که می­تواند بر القاء مرگ سلولی بافت چرب قهوه­ای نیز مؤثر باشد با این وجود در این مطالعه تغییرات شاخص­های اکسایشی اندازه­گیری نشد.  
افزایش خود چربی­های آزاد مضر در جریان خون و تجمع آن­ها در بافت چربی می­توانند در القاء کمپلکس اینفلامازوم نیز مؤثر باشند. در این رابطه بیان شده که استفاده مکرر از روغن­های سرخ کردنی ممکن است به دلیل تبادل اسیدهای چرب بین غذای سرخ شده و روغن و هم­چنین درجه حرارت بالا و فرآیند طولانی سرخ کردن، غلظتTotal fatty acid (TFA)  را افزایش دهد. به عنوان مثال، افزایش غلظت ایزومرهای ترانس C18: 1 در روغن­های گیاهی مختلفی که برای سرخ کردن گوشت گاو استفاده می­شود، دیده شده است. سرخ شدن مکرر در روغن آفتاب­گردان هم­چنین منجر به افزایش غلظت ایزومر TFA C18: 2 شد [24]. این یافته­ها به دلیل تأثیرات احتمالی آن­ها در ارتباط احتمالی بین مصرف غذای سرخ شده و فرکانس بیماری­های قلبی، می‌تواند از اهمیت بالایی برخوردار باشد. از جمله عواملی که می­تواند در کنترل عوامل خطر بیماری­های قلبی عروقی نقش داشته باشد انجام تمرینات هوازی و یا مصرف مکمل‌های آنتی‌اکسیدآنتی‌می­باشد [27-25].
نتایج مطالعه حاضر نشان داد انجام تمرین ورزشی به تنهایی و یا مصرف مکمل به تنهایی کاهش معنی­داری را در ژن nlrp3، aim2 و کاسپاز 9 ایجاد کرد؛ هم­چنین تعامل تمرین و اکتاپامین کاهش معنی­داری را پروتئین NLRP3 ایجاد کرد. در رابطه با تأثیرات تمرین ورزشی به نظر می­رسد انجام مرتب تمرینات ورزشی با افزایش و بهبود متابولیسم چربی TFA (ناشی از روغن حرارت دیده عمیق) و تخریبات ناشی از آن را به حداقل می­رساند زیرا که در مطالعات مختلف نشان داده شده تمرین ورزشی قادر به بهبود پروفایل لیپیدی می­باشد [28]. تغییرات کاهشی در چربی­های جریان خون بعد تغذیه نادرست، می­تواند میزان تجمع و آسیب آن‌ها بر بافت چرب به ویژه قهوه­ای را به حداقل برساند با کاهش این چربی­ها لذا کاهش فاکتورهای اینفلامازوم و هم‌چنین کاسپاز9 مطالعه حاضر نیز معقول به نظر می­رسد.
همسو با نتایج مطالعه حاضر نیز اخیراً Kim و همکاران نشان دادند که انجام تمرین ورزشی با شدت متوسط تأثیرات مثبت و کنترلی بر بیان ژن­های اینفلامازومی و نفوذ ماکروفاژهای MI و M2 در بافت چربی قهوه­ای داشت که این تغییرات با تمرینات تناوبی شدید مغایر نبود [29]. این در حالی بود که تمرینات مطالعه حاضر نیز از نوع تداومی بود که با کاهش اینفلامازوم­های nlrp3 و aim2 همراه بود. گزارش شده است که ناکوت اینفلامازوم nlrp3 در موش مایس از فعال شدن ماکروفاژ مرتبط با چاقی در بافت چربی محافظت می­کند که این امر باعث کاهش فعال شدن ماکروفاژ M1 مانند در بافت چربی و افزایش بیان سیتوکین M2 مانند می­شود [30]. ماکروفاژهای موجود در بافت چربی نقش مهمی در ایجاد شرایط التهابی مزمن و اختلال عملکرد متابولیکی دارند [31]. لذا تمرین ورزشی با کنترل این اینفلامازوم­ها سلامت متابولیکی را نیز تضمین می­کند.  
در رابطه با تأثیر مکمل اکتاپامین نیز به نظر می­رسید به دلیل خاصیت آنتی­اکسیدآنتی‌بالا در تقلیل تخریبات اینفلامازوم­ها به ویژه aim2 بر DNA مؤثر بوده باشد. اکتاپامین علاوه بر نقش آن به عنوان یک آمین بیوژنیک، به عنوان یک جزء فعال مهم در محصولات گیاهی Citrus aurantium [12] و سایر گونه­های مرکبات شناخته شده است [32]. میوه C. aurantium که معمولاً به نارنج معروف است، گاهی اوقات به عنوان غذا استفاده می­شود، اما بیشتر به عنوان مکمل دارویی یا غذایی بلعیده می­شود. ادعا شده است که عصاره­های C. aurantium باعث کاهش وزن می‌شوند. مواد فعال C. aurantium شامل آلکالوئیدهای مختلف با فعالیت آدرنرژیک، از جمله سینفرین و اکتاپامین است [12]. از نظر ساختاری، این اجزای فعال در C. aurantium ارتباط نزدیکی با انتقال دهنده­های عصبی درون زا و افدرین دارند. سینفرین از نظر ساختاری مشابه اپی­نفرین است و اکتاپامین مشابه نوراپی­نفرین است [33]. شباهت به ترکیبات شناخته شده آدرنرژیک و وجود ماده مؤثره C. aurantium که برای اهداف کاهش وزن استفاده می­شود، منجر به مطالعاتی در مورد فعالیت لیپولیتیک اکتاپامین در سلول­های چربی شد مشخص شد که سلول­های چربی قهوه‌ای موش صحرایی با افزایش مصرف اکسیژن و لیپولیز به اکتاپامین پاسخ می­دهند [34]. اخیراً نشان داده شده است که اکتاپامین و سینفرین لیپولیز را در موش­های صحرایی و سلول­های چربی انسانی فعال میکنند [35]. لذا با افزایش لیپولیز مانع از تجمع چربی ناشی از مواد غذایی مضر نظیر DFO می­شوند که در مطالعه حاضر نیز تغییرات کاهشی nlrp3 و aim2 با مصرف اکتاپامین میتواند به کنترل بهتر لیپولیز نسبت داده شود زیرا که شواهدی هم ارائه شده است که اکتاپامین یک آنتاگونیست β3 در سلول­های چربی پستانداران است [36]، که تمام این عوامل در تأثیرات مثبت اکتاپامین می­توانند نقش داشته باشند.
از جمله محدودیت­های مطالعه حاضر می­توان اشاره کرد به: میزان غذای مصرفی حیوانات، میزان جذب دقیق اکتاپامین بعد از گاواژ، اندازه­گیری تمام اجزاء و ترکیبات روغن که میتواند متابولیسم بافت چرب و التهاب آن را تحت تأثیر قرار دهد و بر نتایج تأثیرگذار باشد. که در این مطالعه مقدار غذای مصرفی حیوانات تا حدودی کنترل شد اما سایر موارد با توجه عدم وجود ابزارهای اندازه‌گیری در کشور ارزیابی نشد. لذا پیشنهاد می­شود سایر محققان تا حد ممکن این محدودیت­ها را در مطالعات خود کنترل و بررسی نمایند. هم­چنین برای مطالعات آتی اندازه­گیری شاخص­های پیروپتوز همراه با اینفلامازوم­ها به دنبال تمرین ورزشی هوازی و مصرف مکمل اکتاپامین در بافت چرب قهوه­ای پیشنهاد می­شود. علاوه بر موارد ذکر شده برای اطمینان از تاثیر اکتاپامین بر روی بافتهای بدن پیشنهاد می­شود دوزهای مختلف این مکمل با گروه­های مختلف ارزیابی شود.
نتیجه‌گیری
یافته­های مطالعه حاضر نشان داد که در مقایسه با گروه­ مصرف کننده روغن حرارت دیده عمیق، 4 هفته تمرین هوازی همراه با مکمل اکتاپامین سبب تنظیم منفی اینفلامازوم­ها nlrp3 و aim2، کاهش کاسپاز 9 و گسترش بافت چرب قهوه شد که تمام این تغییرات می­تواند در کنترل عوامل خطر ناشی از بافت چربی بعد از مسمومیت با روغن‌های حرارت دیده عمیق نظیر بیماری­های التهابی، مقاومت به انسولین و بیماری­های قلبی ـ عروقی مؤثر باشد. در این زمینه نیاز به مطالعات بیشتر به ویژه بر روی نمونه‌های انسانی می­باشد.
تشکر و قدردانی
این مطالعه برگرفته از رساله دکتری فیزیولوژی ورزش دانشگاه آزاد اسلامی واحد سنندج است. از معاونت پژوهشی دانشگاه آزاد سنندج جهت حمایت­های معنوی سپاسگزاری می­شود.
 
 
 
 
References
 
 
 
[1]     Cui Y, Hao P, Liu B, Meng X. Effect of traditional Chinese cooking methods on fatty acid profiles of vegetable oils. Food Chem 2017; 2 (33): 77-84.
[2]     Amin MN, Hussain MS, Sarwar MS, Moghal MMR, Das A, Hossain MZ, et al. How the association between obesity and inflammation may lead to insulin resistance and cancer. Diabetes Metab Syndr 2019, 13(2): 1213-24.
[3]     de-Lima-Júnior JC, Souza GF, Moura-Assis A, Gaspar RS, Gaspar JM, Rocha AL, et al. Abnormal brown adipose tissue mitochondrial structure and function in IL10 deficiency. EBioMedicine 2019; 39: p. 436-47.
[4]     Wires ES, Trychta KA, Bäck S, Sulima A, Rice KC, Harvey BK. High fat diet disrupts endoplasmic reticulum calcium homeostasis in the rat liver. J Hepatol 2017; 67(5):1009-17.
[5]     Cavaliere G, Trinchese G, Penna E, Cimmino F, Pirozzi C, Lama A, et al. High-fat diet induces neuroinflammation and mitochondrial impairment in mice cerebral cortex and synaptic fraction. Front Cell Neurosci 2019; 13 (2): 509-15.
[6]     Giordano A, Murano I, Mondini E, Perugini J, Smorlesi A, Severi I, et al. Obese adipocytes show ultrastructural features of stressed cells and die of pyroptosis. J Lipid Res 2013, 54(9): 2423-36.
[7]     Tsuchiya, K. Inflammasome associated cell death: Pyroptosis, apoptosis, and physiological implications. J Microbiol & Immunol 2020; 64(4): 252-69.
[8]     Lian Q, Xu J, Yan S, Huang M, Ding H, Sun X, et al. Chemotherapy-induced intestinal inflammatory responses are mediated by exosome secretion of double-strand DNA via AIM2 inflammasome activation. Cell Res 2017; 27(6): 784-800.
[9]     Cunha LD, Silva AL, Ribeiro JM, Mascarenhas DP, Quirino GF, Santos LL, et al. AIM2 engages active but unprocessed caspase-1 to induce noncanonical activation of the NLRP3 inflammasome. Cell Rep 2017; 20(4): 794-805.
[10]   Kim C-S, Park S, Kim J. The role of glycation in the pathogenesis of aging and its prevention through herbal products and physical exercise. J Exe Nutr Biochem 2017; 21(3): 55-61.
[11]   De Oliveira AL, De Paula MN, Comar JF, Vilela VR, Peralta RM, Bracht A. Adrenergic metabolic and hemodynamic effects of octopamine in the liver. Int J Mol Sci 2013; 14(11): 21858-72.
[12]   Koh AHW, Chess-Williams R, Lohning AE. HPLC-UV-QDa analysis of Citrus aurantium-labelled pre-workout supplements suggest only a minority contain the plant extract. J Pharm Biomed Anal 2021; 19(3): 1137-46.
[13]   Roeder, T. The control of metabolic traits by octopamine and tyramine in invertebrates. J Exp Biol 2020; 223(7): 27-39.
[14]   Abdollahi S, Mohamadzadeh Salamat K, Azizbeigi K, Etemad Z. The effect of 4 weeks of aerobic training and Octopamine on the levels of malondialdehyde and caspase 3 in brown adipose tissue in rats received deeply heated oils treatment. JJUMS 2020; 7(2): 394-403.(Farsi).
[15]   Kianmehr P, Azarbayjani MA, Peeri M, Farzanegi P. Synergic effects of exercise training and octopamine on peroxisome proliferator-activated receptor-gamma coactivator-1a and uncoupling protein 1 mRNA in heart tissue of rat treated with deep frying oil. BB Reports 2020; 22 (4): 1027-35.
[16]   Zhou Z, Wang Y, Jiang Y, Diao Y, Strappe P, Prenzler P, et al. Deep-fried oil consumption in rats impairs glycerolipid metabolism, gut histology and microbiota structure. Lipids Health Dis 2016; 15(1): 86-94.
[17]   Azarbayjani MA, Peeri M, Farzanegi P. The effects of aerobic exercise training with octopamine supplementation on cardiomyocyte apoptosis induced by deep frying oil: the role of caspase and pro-Caspase. BBRC 2020; 35(2): 86-63.
[18]   Fernández Vázquez G, Reiter RJ, Agil A. Melatonin increases brown adipose tissue mass and function in Zücker diabetic fatty rats: implications for obesity control. J Pineal Res 2018; 64(4): 12472-80.
[19]   Almeida-Oliveira F, Leandro JG, Ausina P, Sola-Penna M, Majerowicz D. Reference genes for quantitative PCR in the adipose tissue of mice with metabolic disease. Biomed Pharmacother 2017; 88 (2): 948-55.
[20]   Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2ˆ (–delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics, Bioinformatics & Biomathematics 2013; 3(3): 71-78.
[21]   Lin C, Chao H, Li Z, Xu X, Liu Y, Bao Z, et al. Omega-3 fatty acids regulate NLRP3 inflammasome activation and prevent behavior deficits after traumatic brain injury. Exp Neurol 2017; 290 (4): 115-22.
[22]   Rey-García J, Guallar-Castillón P, Donat-Vargas C, Moreno-Iribas C, Barricarte A, Rodriguez-Barranco M, et al. Fried-Food Consumption Does Not Increase the Risk of Stroke in the Spanish Cohort of the European Prospective Investigation into Cancer and Nutrition (EPIC) Study. J Nutr 2020; 150(12): 3241-48.
[23]   Rašić I, Rašić A, Akšamija G, Radović S. The relationship between serum level of malondialdehyde and progression of colorectal cancer. Acta Clin Croat 2018; 57(3): 411-16.
[24]   Aro A, Van Amelsvoort J, Becker W, van Erp-Baart M-A, Kafatos A, Leth T, et al. TransFatty acids in dietary fats and oils from 14 European countries: the TRANSFAIR study. J Food Compost Anal 1998; 11(2): 137-49.
[25]   Barton M, Cardillo C. Exercise is medicine: key to cardiovascular disease and diabetes prevention. Cardiovasc Res 2020; 27(4.): 138-43.
[26]   Ingles DP, Rodriguez JBC, Garcia H. Supplemental vitamins and minerals for cardiovascular disease prevention and treatment. Curr Cardiol Rep 2020; 22(4): 1-8.
[27]   Abdollahi S, Mohamadzadeh Salamat K, Azizbeigi K, Etemad Z. The Simultaneous Effects of Aerobic Training and Octopamine on the Mitophagy of the Brown Adipose Tissue after the Induction of Intoxication by Deeply Heated Oil in Male Wistar Rats. JNFH 2020; 8(3): p. 151-58.
[28]   Nybacka Å, Hellström PM, Hirschberg AL. Hirschberg, Increased fibre and reduced trans fatty acid intake are primary predictors of metabolic improvement in overweight polycystic ovary syndrome—Substudy of randomized trial between diet, exercise and diet plus exercise for weight control. Clin Endocrinol 2017; 87(6): 680-88.
[29]   Kim Y-A, Pitriani P, Park H-G, Lee W-L. Moderate Intensity Exercise Has More Positive Effects on The Gene Expression of Inflammasome, M1, M2 Macrophage Infiltration and Brown Adipocyte Markers Compared to High Intensity Exercise in Subcutaneous Adipose of Obese Mice Induced By High Fat Diet. Immun Res 2019; 29(3): 303-10.
[30]   Harms M, Seale P. Brown and beige fat: development, function and therapeutic potential. Nat Med 2013; 19(10): 1252-63.
[31]   Bai Y, Sun Q. Macrophage recruitment in obese adipose tissue. Obes Rev 2015. 16(2): 127-36.
[32]   Koh AHW, Chess-Williams R, Lohning AE. Differential mechanisms of action of the trace amines octopamine, synephrine and tyramine on the porcine coronary and mesenteric artery. Sci Rep 2019; 9(1): 1-9.
[33]   Wu SF, Jv XM, Huang JM, Gao CF. Molecular features and expression profiles of octopamine receptors in the brown planthopper, Nilaparvata lugens. Pest Manag. Sci 2019; 75(10): 2663-71.
[34]   Carpéné C, Galitzky J, Fontana E, Atgié C, Lafontan M, Berlan M. Selective activation of β3-adrenoceptors by octopamine: comparative studies in mammalian fat cells. Naunyn Schmiedebergs Arch Pharmacol 1999; 359(4): 310-21.
[35]   Mercader J, Wanecq E, Chen J, Carpéné C. Isopropylnorsynephrine is a stronger lipolytic agent in human adipocytes than synephrine and other amines present in Citrus aurantium. J Physiol Biochem 2011; 67(3): 443-52.
[36]   Shokri F, Azarbayjani MA, Peeri M, Ghazalian F. The Effect of Octopamine and Aerobic Exerciseand on Genes Affecting Angiogenesis of Visceral Adipose Tissue in Rats Fed with Deep-Fried Oil. JNFH 2020; 8(3): 192-98.


 
The Effect of Aerobic Exercises and Octopamine Consumption on Changes in Gene Expression of Caspase-9, NLRP3, AIM2 in Brown Adipose Tissue of Rats after Intoxication with Deep Fried Oil: An Experimental Study
 
 
 
N. Darvishzadeh[4], K. Azizbeigi[5], Z. Etemad[6]
 
Received:11/01/21       Sent for Revision: 01/02/21     Received Revised Manuscri pt:28/02/21     Accepted: 03/03/21
 
 
Background and Objectives: Regular aerobic exercises along with herbal supplements can control inflammation. The aim of this study was to investigate the effect of aerobic exercises and octopamine consumption on gene changes of NLR family pyrin domain containing 3 (NLRP3), absent in melanoma 2 (AIM2) and caspase 9 in brown adipose tissue in rats after consuming deep fried oil.
Materials and Methods: The present study was an experimental study. Forty male Wistar rats were randomly divided into groups of 8 included: healthy control, control poisoned with fried oil, poisoned + aerobic exercise, poisoned + octopamine, and poisoned + aerobic exercise + octopamine. The fried oil was fed orally to rats for 4 weeks. The dose of Octopamine was 81μmol/kg. The aerobic exercise groups also trained on the treadmill with increasing intensity for four weeks. Real time PCR and IHC methods were used to determine changes in NLRP3, AIM2, caspase 9 genes as well as changes in NLRP3 protein expression, respectively. Two-way analysis of variance was used to analyze the data.
Results: Aerobic exercise caused a significant decrease in NLRP3 (p=0.010) and AIM2 (p=0.001) gene expression compared to the poisoned control group. Octopamine supplementation also significantly reduced NLRP3 (p=0.009) and AIM2 (p=0.001) gene expression. The interaction of exercise and aerobic exercise caused a significant decrease in NLRP3 protein (p=0.001).
Conclusion: Applying 4 weeks of exercise or taking octopamine alone by controlling the inflammasome complex reduces cell death in brown adipose tissue, which is effective in browning and making adipose tissue more efficient.
Key words: Apoptosis, NLRP3, AIM2, Brown adipose tissue, Aerobic exercise, Octopamine, Deep fried oil
 
Funding: This study did not have any funds.
Conflict of interest: None declared.
Ethical approval: The Ethics Committee of the Faculty of Veterinary Medicine, Sannandaj University approved the study (IR.MUK.REC.1398.242).
 
How to cite this article: Darvishzadeh N, Azizbeigi K, Etemad Z. The Effect of Aerobic Exercises and Octopamine Consumption on Changes in Gene Expression of Caspase-9, Nlrp3, Aim2 in Brown Adipose Tissue of Rats after Intoxication with Deep Fried Oil: An Experimental Study. J Rafsanjan Univ Med Sci 2021; 20 (1): 37-52. [Farsi]


 
[1]- دانشجوی دکتری، گروه تربیت بدنی، واحد سنندج، دانشگاه آزاد اسلامی، سنندج، ایران
[2]- دانشیار، گروه تربیت بدنی، واحد سنندج، دانشگاه آزاد اسلامی، سنندج، ایران
    تلفن: 33288661-087، دورنگار: 33288661-087، پست الکترونیکی: kazizbeigi@gmail.com
[3]- استادیار، گروه تربیت بدنی، واحد سنندج، دانشگاه آزاد اسلامی، سنندج، ایران
 
  1. - PhD Student, Dept. of Physical Education, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran, ORCID: 0000-0001-7393-7142
  1. - Associate Prof., Dept. of Physical Education, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran, ORCID: 0000-0002-5963-2323
   (Corresponding Author) Tel: ( 087) 33288661, Fax: (087) 33288661, E-mail: kazizbeigi@gmail.com
  1. - Assistant Prof., Dept. of Physical Education, Sanandaj Branch, Islamic Azad University, Sanandaj, Iran, ORCID: 0000-0001-5109-9571

 [j1]نویسنده مسئول کیست؟ در قسمت فارسی و انگلیسی مشخص شود.
نوع مطالعه: پژوهشي | موضوع مقاله: تربيت بدني
دریافت: 1399/10/18 | پذیرش: 1399/12/13 | انتشار: 1400/2/1

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2024 CC BY-NC 4.0 | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb