جلد 18، شماره 12 - ( 12-1398 )                   جلد 18 شماره 12 صفحات 1252-1233 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Sabahi M, Hamdi S M, Mirzaie A. Anti-biofilm Activity of Synthesized Silver Nanoparticles Using Asphodelus dendroides Extract against Antibiotic Resistant and Biofilm Forming Klebsiella pneumoniae Clinical Strains: A Laboratory Study. JRUMS 2020; 18 (12) :1233-1252
URL: http://journal.rums.ac.ir/article-1-4836-fa.html
صباحی مهتاب، حمدی سید محمد مهدی، میرزایی امیر. اثرات ضد بیوفیلمی‌نانوذرات نقره سنتز شده توسط عصاره گیاه سریشک (Asphodelus dendroides) بر روی ایزوله‌های بالینی مقاوم به آنتی‌بیوتیک و مولد بیوفیلم کلبسیلا پنومونیه: یک مطالعه آزمایشگاهی. مجله دانشگاه علوم پزشکی رفسنجان. 1398; 18 (12) :1233-1252

URL: http://journal.rums.ac.ir/article-1-4836-fa.html


دانشگاه آزاد اسلامی
متن کامل [PDF 693 kb]   (915 دریافت)     |   چکیده (HTML)  (2276 مشاهده)
متن کامل:   (1626 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 18، اسفند 1398، 1252-1233
 
اثرات ضد بیوفیلمی‌نانوذرات نقره سنتز شده توسط عصاره گیاه سریشک (Asphodelus dendroides) بر روی ایزوله­های بالینی مقاوم به آنتی‌بیوتیک و مولد بیوفیلم کلبسیلا پنومونیه: یک مطالعه آزمایشگاهی
 
مهتاب صباحی[1]، سید محمد مهدی حمدی[2]، امیر میرزایی[3]
 
 
دریافت مقاله: 9/4/98     ارسال مقاله به نویسنده جهت اصلاح: 5/8/98      دریافت اصلاحیه از نویسنده: 18/8/98         پذیرش مقاله: 9/9/98
 
چکیده
زمینه و هدف: سنتز نانوذرات نقره توسط عصاره گیاهان یکی از روش­های مقرون به صرفه می­باشد و یکی از کاربردهای نانوذرات نقره، اثرات ضد میکروبی و ضد بیوفیلمی‌آن می­باشد و هدف از این مطالعه تعیین اثرات ضدبیوفیلمی‌ نانوذرات نقره سنتز شده توسط عصاره گیاه سریشک بر روی ایزوله­های بالینی کلبسیلا پنومونیه مقاوم به آنتی‌بیوتیک و مولد بیوفیلم است.
مواد و روش­ها: در این مطالعه آزمایشگاهی، ابتدا نانوذرات نقره توسط عصاره گیاه سریشک سنتز گردید و خصوصیات ساختاری آن توسط روش­های فیزیکی و شیمیایی مختلف تأیید شد. به دنبال آن اثرات ضد میکروبی و ضد بیوفیلمی نانوذرات نقره سنتز شده بر روی ایزوله­های بالینی کلبسیلا پنومونیه مولد بیوفیلم به ترتیب توسط روش­های کمترین غلظت بهینه و Real Time PCR بررسی گردید.
یافته­ها: نتایج تست UV-vis نشان داد که نانوذرات نقره سنتز شده دارای بیشینه جذب در طول موج 420 نانومتر بود. نتایج SEM (scanning electron microscopeTEM (transmission electron microscopy) و XRD (X-ray powder diffraction) نشان داد که نانوذرات نقره سنتز شده دارای ساختار کروی و دارای اندازه میانگین و انحراف معیار 22±41/30 نانومتر بودند. همچنین نانوذرات نقره دارای اثرات ضد میکروبی و ضد بیوفیلمی معنی­داری علیه سویه­های کلبسیلا پنومونیه داشتند، به­طوری­که نانوذرات نقره باعث کاهش بیان معنی­دار ژن کدکننده بیوفیلم (mrkA) در سویه­های کلبسیلا پنومونیه شده بود (001/0P <).
نتیجه­گیری: نتایج این مطالعه اثرات ضد میکروبی و ضد بیوفیلمی نانوذرات نقره علیه سویه­های کلبسیلا پنومونیه را نشان داد. با توجه به نتایج این مطالعه، با انجام مطالعات تکمیلی احتمالاً بتوان از این ترکیب در آینده برای مهار بیوفیلم استفاده نمود.
واژه­های کلیدی: نانوذرات نقره، کلبسیلا پنومونیه، اثرات ضد میکروبی، اثرات ضد بیوفیلمی، ژن mrkA  
 
 
 
 
مقدمه
امروزه گسترش استفاده از آنتی‌بیوتیک­ها باعث ایجاد مقاومتهای دارویی و به­وجود آمدن باکتری­های مقاوم به چند دارو (Multi Drug Resistant) شده است ]2-1[، به‌طوری­که 70 درصد از باکتری­هایی که باعث ایجاد عفونت در بیمارستان­ها می­شوند، حداقل به یکی از داروهای رایج درمانی مقاوم شده­اند ]4-3[. باکتری­های تولید کننده آنزیم‌های بتالاکتاماز وسیع­الطیف یکی از معضلات جدید در درمان باکتری­ها شده­اند، به­طوری­که این باکتری­ها توانایی از بین بردن سفالوسپورین­های نسل سوم را دارند ]5[.
یکی از مهم­ترین باکتری­های تولیدکننده آنزیم بتالاکتاماز وسیع­الطیف، باکتری­های خانواده انتروباکتریاسه به­خصوص کلبسیلا پنومونیه می­باشد ]6[. یکی دیگر از دلایل مقاومتهای دارویی باکتری­ها بخصوص کلبسیلا پنومونیه، تولید بیوفیلم می­باشد. بیوفیلم­ها جمعیتی از باکتری­های درحال رشد هستند که تولید ماتریکس اگزوپلیمری می­کنند و به سطوح متصل می­شوند ]7[. از طرف دیگر، ماتریکس یک بیوفیلم موجب نفوذ آرام و ناکافی ترکیبات ضدمیکروبی شده و گرادیان غلظتی موجود در نقاط مختلف آن قادر به خنثی سازی برخی از ترکیبات راه یافته به درون بیوفیلم می­شود ]8[.
یکی از ژن­های مؤثر در تشکیل بیوفیلم در سویه­های بالینی کلبسیلا پنومونیه، ژن mrkA (Type 3 Fimbrial Shaft) میباشد و مطالعات نشان داده است که این ژن اتصال سویههای کلبسیلا پنومونیه را به سطوح مختلف تسهیل نموده و سبب تشکیل بیوفیلم می­گردد ]9[. توانایی تولید بیوفیلم در باکتری کلبسیلا پنومونیه توانایی زنده ماندن آن را در محیطهای خشن در میزبان را می­دهد و مسئول ایجاد عفونتهای مزمن و پایدار می­باشد ]10[.
یکی از راه­کارهای مقابله با تولید بیوفیلم و مقاومت آنتی‌بیوتیکی، استفاده از علم نانوتکنولوژی می­باشد ]11[. یکی از نانوذرات مورد استفاده جهت از بین بردن بیوفیلم باکتریایی، نانوذرات نقره می­باشد ]13-12[. تاکنون مطالعات کمی در زمینه بررسی اثرات ضد بیوفیلمی نانوذرات نقره به انجام رسیده است. Gutierrez و همکارانش اثرات ضد بیوفیلمی‌ نانوذرات نقره را بروی باکتری­های مختلف پاتوژن مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که نانوذرات نقره در غلظت 100 میکروگرم در میلی‌لیتر باعث جلوگیری از تولید بیوفیلم در سویه­های سودوموناس آئروژینوزا می­شود ]14[.
امروزه به منظور سنتز نانوذرات نقره روش­های فیزیکی و شیمیایی از جمله احیاء شیمیایی، لیتوگرافی، الکتروشیمیایی، لیزر و امواج میکروویو متفاوتی وجود دارد. از معایب روش­های شیمیایی که نقش عوامل احیایی و تثیبت کننده را ایفاء میکنند، این است که در طبیعت به صورت تجزیه نشده باقی می­مانند و در نهایت موجب آلودگی شیمیایی محیط زیست می­شوند ]15[. اخیراً سنتز زیستی نانوذرات نقره توسط عوامل طبیعی و زیستی مانند گیاهان مورد توجه محققان قرار گرفته است ]16[. تاکنون از گیاهان مختلفی مانند Plumbago zeylanica، Albizia adianthifolia، Acacia leucophloea, Chrysanthemum indicum L., Achillea biebersteinii, Lantana camara. جهت سنتز نانوذرات نقره استفاده کرده­اند ]17[.
در این مطالعه از عصاره گیاه سریشک (Asphodelus dendroides) جهت سنتز سبز نانوذرات نقره استفاده شد. سریشک نام یک سرده از زیرخانواده علف‌ درختان آسفودلویدآ است. سریشک گیاهی است که غالباً در جنوب و کشورهای شمال آفریقا و پاکستان و هندوستان مشاهده میشود و فصل گلدهی آن از اواسط اردیبهشت ماه تا اواسط خرداد است. عصاره این گیاه، در درمان ناراحتی­های کبد و معده مؤثر است و به عنوان ضد عفونی کننده در طب سنتی استفاده می­شود ]18[. با توجه به این­که مطالعات نشان میدهد که عصاره این گیاه دارای ترکیبات ثانویه فلاوونوئیدها و ترپنوئیدها می­باشد و این ترکیبات نقش به‌سزایی در سنتز نانوذرات نقره دارند و بنا به اثرات درمانی عصاره این گیاه و کاربردهای وسیع نانوذرات نقره، هدف از این مطالعه برای اولین بار سنتز بیولوژیک نانوذرات نقره با استفاده از عصاره گیاه سریشک و اثرات ضد بیوفیلمی آن بروی ایزوله­های بالینی کلبسیلا پنومونیه می­باشد. 
مواد و روش­ها
در این مطالعه آزمایشگاهی که از اردیبهشت ماه 97 تا شهریور ماه 97 در دانشگاه آزاد اسلامی‌واحد تهران مرکز به انجام رسیده است و دارای کد اخلاق IR.IAU, Tehran.REC.1397.019 می‌باشد، تعداد 50 نمونه مشکوک به کلبسیلا پنومونیه از بیماران مراجعه کننده بیمارستان امام خمینی شامل ادرار، زخم، مایع مغزی-نخاعی، خون و خلط جمع‌آوری شدند. نمونه­ها پس از انتقال به آزمایشگاه‌ تحقیقاتی میکروبشناسی روی محیط­های کشت ائوزین متیلن بلو آگار (EMB) و مک کانکی (مرک، آلمان) آگار کشت داده شدند و در 37 درجه سانتی­گراد به مدت 24 ساعت نگهداری شدند. بعد از تهیه لام و مشاهده باسیل­های گرم منفی، تستهای بیوشمیایی معمول نظیر کشت در محیط­های کشت (Sulfide, Indole, Motility) SIM، Triple Sugar Iron Agar (TSI)، Voges-Proskauer و Methyl Red (MRVP)، اوره و سیترات و تست اکسیداز (مرک، آلمان) برای تأیید کلبسیلا پنومونیه انجام شد. سپس باکتری­ها در محیط ترپتیک سوی براث  (TSB) و گلیسرول در 70- درجه سانتیگراد برای انجام تست­های بعدی مطالعه و ذخیره شدند ]19[. تست حساسیت ضد میکروبی با روش کربی بائر انتشار (دیسک دیفیوژن) روی محیط کشت مولر هینتون آگار، نسبت به دیسک­های آنتی‌بیوتیکی (MAST, UK) سفتری اکسون (CRO, 30 µg)، سفتازیدیم (CAZ, 30 µg)، سفوکسیتین (FOX, 30 µg)، سفوتاکسیم (CTX, 30 µg)، نالیدیکسیک اسید (NA, 30 µg)، سیپروفلوکساسین (CP, 5 µg)، ایمی‌پینم (IPM, 10 µg) انجام شد و نتایج طبق راهنمای CLSI (2018) بررسی شد ]20[.
جهت تعیین سویه­های کلبسیلا پنومونیه مولد بیوفیلم، سویه­ها بر روی محیط کشت گنگورد آگار دارای 40 گرم سوکروز کشت داده شدند و به مدت 24 ساعت در دمای 37 درجه سانتی­گراد انکوبه گذاری شدند (Memert, Germany) و سپس به مدت 24 ساعت در دمای اتاق قرار گرفتند. کلنیهای سیاه رنگ به عنوان سویه­های مولد بیوفیلم و کلنیهای قرمز روشن به عنوان سویه­های فاقد قدرت بیوفیلم شناسایی شدند ]21[.
گیاه سریشک از بانک گیاهی مرکز ذخایر زیستی با شماره هرباریومی 1395 خریداری شد. اندام هوایی گیاه ابتدا در جریان هوا قرار داده و سپس در سایه کاملاً خشک شدند و توسط دستگاه آسیاب برقی (IKA M20 Universal, China) کاملا پودر گردیده و درون ظرف­های شیشه­ای نگهداری شدند. از پودر تهیه شده برای عصاره­گیری اتانولی با استفاده از روش ماسراسیون استفاده شد. عصاره به دست آمده توسط کاغذ صافی (واتمن، آلمان) فیلتر شد و جهت سنتز نانوذرات نقره، از روش رسوب­گذاری با احیای یونهای نقره توسط عصاره گیاه سریشک انجام گرفت. به این صورت که نانوذرات نقره با افزودن 2 میلی‌لیتر عصاره با غلظت mM 001/0 از نیترات نقره (مرک، آلمان) تحت شرایط دمایی 60 درجه سانتی‌گراد و همزدن سنتز  شدند. احیای کامل یون‏های نقره به نانوذرات نقره با تغییر رنگ محیط مشخص  می­شود. پس از سپری شدن یک ساعت از زمان واکنش و تغییر رنگ محلول، سه مرتبه شستشوی رسوب با آب مقطر انجام می‌گیرد. تمامی مراحل شستشو با دور rpm 13000 به مدت 20 دقیقه سانتریفیوژ (Hettich, Germany) می­گردد. در نهایت رسوب نهایی بعد از خشک شدن در شیشه ساعت جمع­آوری می­شود ]22[.
بعد از گذشت 60 دقیقه از زمان واکنش رسوب­گذاری، تغییر رنگ واکنش و سنتز نانوذرات نقره، آنالیز طیف سنجی مرئی فرابنفش نانوذرات نقره سنتز شده با استفاده از دستگاه طیف سنجی UV-vis (JASCO V-670 Spectrophtometer, USA) بین 200 تا 700 نانومتر مورد ارزیابی قرار گرفت ]17[. به منظور تعیین ساختار کریستالوگرافی نانوذرات نقره از آزمون اشعه ایکس توسط دستگاه XRD با تشعشع لامپ CuKa (Olympus ، ژاپن) در دامنه 0 تا 110 درجه استفاده شد. به منظور بررسی ریخت شناسی و تأیید اندازه نانوذرات نقره، یک قطره از نمونه سوسپانسیونی ذرات نقره بر روی گرید فیلم کربنی قرار داده شد و پس از خشک شدن آن در دمای آزمایشگاه با استفاده از دستگاه میکروسکوپ الکترونی گذاره (Leo 906) (TEM مدل KV 100( Zeiss، ساخت کشور آلمان با ولتاژ شتاب دهنده Kv120 تصویر برداری شد.
مورفولوژی نانوذرات نقره با استفاده از میکروسکوپ الکترونی روبشی (SEM) (شرکت KYKY، کشور ژاپن) بررسی شد. تصاویر میکروسکوپ الکترونی روبشی و مطالعه نقطه به نقطه، جهت بررسی اندازه و مورفولوژی نانوذرات پس از پوشش دهی با طلا در ولتاژ زیر KV 30  و تحت فشار خلاء (10-5 Torr) با استفاده از میکروسکوپ الکترونی ­مدل XL30­ شرکت فیلیپس ساخت کشور ژاپن مورد مطالعه قرار گرفت. نانوذرات در مقداری آب حل شده و سوسپانسیون حاصل روی گرید طلا مورد تصویربرداری SEM قرار گرفت. دستگاه لایه نشانی طلا Sputter coater، ساخت شرکت KYKY، کشور ژاپن و مدل دستگاه SBC12 بود ]23[.
به منظور بررسی خواض ضد باکتریایی نانوذرات نقره از روش کم­ترین غلظت مهارکنندگی (MIC) ‌استفاده شد. آزمایش MIC به­صورت سه بار تکرار بر اساس استاندارد CLSI به روش میکرودایلوشن در میکروپلیت 96 خانه­ای انجام گرفت. حداقل غلظت مهاری (MIC) به کم­ترین غلظت از نانوذره نقره که رشد میکروارگانیسم را مهار می­نماید، اطلاق می شود. به این منظور ابتدا، نانوذرات نقره در غلظت‌های (100، 50، 25، 5/12، 25/6، 125/3 میکرو گرم بر میلی‌لیتر) تهیه شد. طرز تهیه غلظت­های مختلف نانوذرات نقره، استفاده از روش رقیق‌سازی متوالی بود یعنی ابتدا غلظت 100 میکروگرم در میلی‌لیتر از نانوذرات نقره ساخته شد و به صورت متوالی رقیق‌سازی شد (به نسبت 2/1) ]23[. به دنبال آن پلیت­های 96 چاهکی به کمک توزیع 95 میکرولیتر از محیط مولرهینتون براث و 5 میکرولیتر از تلقیح میکروبی (نمونه­های جداسازی شده کلبسیلا پنومونیه) به داخل هر یک از چاهکها فراهم گردید. 100 میکرولیتر از نانوذرات در غلظتهای مختلف در چاهک­ها ریخته شد. چاهک آخر شامل 95 میکرولیتر محیط مولر هینتون براث و 5 میکرولیتر از تلقیح میکروبی در هر ردیف به منزله کنترل مورد استفاده قرار گرفت. پلیت با درپوش پلیت‌استریل پوشانده شد و محتویات هر چاهک روی شیکر (Cleaver Scientific، UK)  به مدت 60  ثانیه با دور rpm 100 مخلوط گردید و سپس در دمای 37 درجه به مدت 24 ساعت انکوبه شد و بعد از مدت زمان 24 ساعت رشد یا عدم رشد میکروبی بررسی شد ]23[.
به منظور تعیین اثرات ضدبیوفیلمی نانوذرات نقره از روش Real Time PCR استفاده شد ]24[ به­طوری ­که ابتدا سویههای کلبسیلا پنومونیه با غلظت زیرحد MIC (SubMIC) نانوذرات نقره تیمار شدند و به دنبال آن از سویه­های تحت تیمار با نانوذره، استخراج RNA با استفاده از کیت استخراج RNA (کیاژن، آمریکا) بر طبق دستورالعمل انجام گرفت. در ادامه، سنتز cDNA با استفاده از کیت Quanti Tect Reverse Transcription kit (کیاژن، آمریکا) انجام گرفت. به منظور ارزیابی بیان ژن بیوفیلم mrkA از روش Real Time PCR کمی‌Quantitative Real-Time-PCR (qRT-PCR)) با استفاده مسترمیکس حاوی سایبرگرین (Applied Biosystem، انگلستان) انجام گرفت. مواد مورد استفاده در حجم 20 میکرولیتر مسترمیکس شامل 2 میکرولیتر از cDNA، 10 پیکومول از پرایمرهای رفت و برگشت، 10 میکرولیتر از مسترمیکس حاوی سایبر گرین بود که در دستگاه Bioneer کره انجام گرفت برنامه دمایی مورد استفاده در qPCR شامل 90 درجه سانتی‌گراد به مدت 10 دقیقه، 95 درجه سانتی‌گراد 15 ثانیه، 1 دقیقه دمای 60 درجه سانتی‌گراد بود که در 40 سیکل انجام شد. هم چنین ژن 16S rRNA به عنوان کنترل داخلی مورد استفاده قرار گرفت. در انتها بیان نسبی ژن mrkA توسط روش ΔΔCт محاسبه گردید. لازم به ذکر است پرایمرهای مورد استفاده برای ژن mrkA F 5/- TTCTTCTCTCTGCAGCAATG -3’ و mrkA R-5’- TACCGGAGACAGGTAAACGT -3’ و هم‌چنین F5’- GAGCGGCGGACGGGTGAGTA -3’ 16SrRNA و 16SrRNA -R 5’- GGGCACATCTGATGGCATGA -3’ بود ]24[
در این مطالعه تمامی‌تست ها به­صورت 3 بار تکرار انجام شد و نتایج توسط نرم افزار SPSS  نسخه 20 و با استفاده از آزمون آماری آنالیز واریانس یک­طرفه مورد تجزیه و تحلیل قرار گرفت و 05/0P<  به عنوان اختلاف معنیدار در نظر گرفته شد. نتایج به صورت انحراف از معیار ± میانگین گزارش شد.  
نتایج
در این مطالعه، از میان 50 نمونه بالینی مشکوک به کلبسیلا پنومونیه، کلنی­های لاکتوز مثبت و موکوئیدی جداسازی شد و با استفاده از تست­های میکروسکوپی و بیوشیمیایی، تعداد 20 سویه کلبسیلا پنومونیه جداسازی گردید. نتایج تست حساسیت میکروبی نشان داد که سویه‌های کلبسیلا پنومونیه جداسازی شده دارای پروفایل مقاومت آنتی­بیوتیکی متنوعی هستند که در جدول 1 نشان داده شده است، به­طوری­که اکثر سویهها مقاوم به چند دارو (MDR) بودند.
 
جدول 1- نتایج تست آنتی بیوگرام 20 سویه کلبسیلا پنومونیه جداسازی شده از نمونه های بالینی
 
نام آنتی بیوتیک شماره سویه
ایمی‌پنم سیپروفلوکساسین نالیدیکسیک اسید سفوتاکسیم سفوکسیتین سفتازیدیم سفتری اکسون
S R R R R R R 2
R R R R S R R 6
R R S R R R R 7
R R R R R S R 9
S R R R R R S 11
R R R R R R R 16
R R R S I R R 19
S R R R R R S 22
S R S R R R R 23
S R R R R R S 25
S I R R R R R 26
R R S R R R S 31
S S R I R R R 33
R R R R I S R 39
I R R R R R R 40
S R R R R S R 42
S R R R R R R 44
I S R R R R I 46
S R I R R R R 49
S R R S R R R 50
 
R: مقاوم، I: نیمه حساس، S: حساس
 
 
در این مطالعه، از محیط کشت کنگورد آگار برای بررسی فنوتیپی بیوفیلم استفاده شد. باکتری­های بیوفیلم مثبت کلنی­های مشکی رنگ تولید می‌کنند در صورتی که باکتریهای فاقد بیوفیلم به همان حالت اولیه یعنی قرمز رنگ باقی میمانند. از میان 20 سویه بالینی کلبسیلا پنومونیه، تمامی‌سویهها از نظر تست فنوتیپی بیوفیلم مثبت بودند (شکل 1).
 
 
A
B
 
 
 
 
 
 
 

شکل 1- نتایج تست فنوتیپی بیوفیلم. A: کلنی های بی رنگ (بیوفیلم منفی)، B: کلنی های مشکی رنگ (بیوفیلم مثبت).
 
 
واکنش احیاء محلول نیترات نقره در دمای اتاق بعد از اضافه کردن عصاره خشک شده به محلول نیترات نقره صورت گرفت و تغییر رنگ حاصل گردید که این تغییر رنگ نشان دهنده ساخت نانوذرات نقره بود (شکل 2). بعد از سانتریفیوژ به مدت 20 دقیقه با دورrpm  9000  و به دست آوردن رسوب نانوذرات نقره و چندین مرحله شست و شو از پودر خشک شده نانوذرات نقره برای آنالیز TEM، SEM، XRD، UV-Vis استفاده شد. به منظور بررسی و آنالیز ریختشناسی و اندازه نانوذرات نقره سنتز شده از میکروسکوپ الکترونی TEM و SEM استفاده شد. نتایج TEM و SEM نشان داد که نانوذرات نقره سنتز شده دارای ساختار کروی و دارای میانگین سایز 41/30 نانومتر بود (شکل 3A-3B و 3C). همان طورکه نتایج سنجش چگالی نوری نانوذرات نقره نشان می‏دهد حداکثر میزان جذب محلول­های حاوی نانوذرات نقره در طول موج 420 نانومتر است (شکل 4). طیف سنجی XRD به منظور اثبات نانوکریستال­های فلزی نقره، انجام شد. بر اساس نتایج به دست آمده که در طیف نشان داده شده است (شکل 5A)، نانوذرات کریستالی نقره در سطوح 111، 200، 220 و 311 به ترتیب پیک هایی با مقادیر 1/38، 225/46، 51/64 و 82/76 را نشان داد که با نمونه استاندارد نانوکریستالهای نقره (شکل 5B) کاملاً همخوانی دارد. پیک­های اضافی مربوط به ناخالصی‏هایی است که در بافت گیاه وجود داشته و دارای ساختار کریستالی است.
 
 
 
 
 
 
 
 

شکل 2- سنتز نانوذرات نقره (سمت راست، محلول نیترات نقره و سمت چپ، پس از افزودن عصاره گیاهی)
 B
A
C
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

شکل 3- نتایج میکروسکوپ الکترونی گذاره (TEM) (A)، نگاره (SEM) (B) و میانگین سایز نانوذرات (C). همان­طور که مشاهده می­شود نانوذرات سنتز شده دارای ساختاری کروی و دارای میانگین اندازه 41/30 نانومتر می باشد.
 

 
 
 
 
 
 
شکل 4- طیف سنجی UV-Vis‌ نانوذرات نقره سنتز شده. با توجه به شکل، جذب UV نانوذرات نقره سنتز شده در طول موج بین 250 تا 700 نانومتر خوانده شد و ماکزیم جذب در طول موج 438 نانومتر بود.
 
 
A
B
 
 
 
 
 
 
 
 
 
 
 
 
 
 

شکل 5- (A): طیق XRD نانونقره سنتز شده، B: طیف XRD نمونه استاندارد نانوکریستال­های نقره
 
 
 
در این مطالعه، به منظور تعیین اثرات ضد باکتریایی نانوذرات نقره از روش MIC استفاده شد. در روش MIC سویههای باکتریایی کلبسیلا پنومونیه تحت غلظت­های 125/3 تا 100 میکروگرم در میلی­لیتر قرار گرفتند. نتایج نشان داد که نانوذره نقره روی تمامی‌باکتریهای مورد مطالعه خاصیت ضد باکتریایی دارد و کم­ترین و بیشترین غلظت MIC برابر بود با 25/6 و 100 میکروگرم در میلی‌لیتر (جدول 2).
 
 
جدول 2- نتایج MIC نانوذرات نقره علیه سویه­های کلبسیلا پنومونیه
31 26 25 23 22 19 16 11 9 7 6 2 شماره سویه
25 50 50 100 50 25 5/12 25/6 5/12 25 25 25/6 MIC (میکروگرم در میلی لیتر)
- - 50 49 46 44 42 40 39 33
 
50 49 شماره سویه
    25/6 50 100 100 50 5/12 5/12 25/6 25/6 25
 
MIC (میکروگرم در میلی لیتر)
 
بیان نسبی ژن بیوفیلم mrkA در ایزوله­های بیوفیلم مثبت که تحت تأثیر نانوذرات نقره قرار گرفته بودند، توسط روش Real Time PCR مورد مطالعه قرار گرفتند. نتایج نشان داد که سویه­های مختلف در غلظت subMIC از نانوذرات نقره، تغییر بیان ژن mrkA را داشتند و از نظر آماری تفاوت معنیداری در کاهش بیان ژن mrkA در مقایسه با بیان ژن 16S rRNA داشتند (05/0p<). نتایج حاصل از تغییر بیان ژن mrkA در سویه­های بیوفیلم مثبت در نمودار 1 و نمودار حاصل از تکثیر و منحنی ذوب شکل­های 7a و 7b آمده است.
 
 
شکل 6- میزان بیان ژن mrkA در سویه­های مختلف کلبسیلا پنومونیه تحت تیمار با نانوذره نقره در مقایسه با ژن خانه­دار 16S rRNA. نتایج معنی­دار بیان ژن mrkA در سویه­های کلبسیلا پنومونیه به صورت مقایسه با ژن کنترل (16S rRNA) گزارش شده است ( *** 001/0P < : n=3). همان­طور که مشاهده می­شود با در نظر گرفتن ژن مرجع، تمامی سویهها کاهش بیان معناداری داشته اند.
 
 
A
 
 
 
 
 


 
 
 
 
 
 
 
 
B

 
 
 
 
 
 
 
 
 
 
شکل 7- A: نمودار تکثیر Real Time PCR نمونه­های بالینی کلبسیلا پنومونیه، B: نمودار آنالیز منحنی ذوب. قرمز: ژن 16S rRNA، سبز: ژن mrkA
 
 
بحث
در این مطالعه برای اولین بار نانوذرات نقره با استفاده از عصاره گیاه سریشک سنتز شدند. نانوذرات نقره با استفاده از روش­های میکروسکوپ الکترونی روبشی و گذاره تعیین ساختار شدند. نتایج نشان داد که نانوذرات نقره سنتز شده کروی و دارای اندازه میانگین 41/30 نانومتر می­باشد. به دنبال آن اثرات ضد میکروبی و ضد بیوفیلمی‌نانوذرات نقره به روش Real Time PCR بررسی شد. تولید بیوفیلم و ایجاد مقاومتهای دارویی در سویه­های باکتریایی بخصوص کلبسیلا پنومونیه یکی از معضلات اخیر و مورد توجه محققان در سرتاسر دنیا می‌باشد، اما هنوز اطلاعات کمی‌در مورد مهارکننده­های تولید بیوفیلم در سویه­های مقاوم به آنتی‌بیوتیک کلبسیلا پنومونیه وجود دارد ]25[. تاکنون ترکیبات ضد بیوفیلمی‌کمی‌توسط محققان گزارش شدهاند. Wood و همکارانش چندین ترکیب ضد بیوفیلم باکتری اشرشیا ­کلی مانند brominated furanones، ursolic acid، مشتقات ایندول و 5 فلئورویوراسیل را گزارش کردهاند ]26[. مکانیسم مقاومت به آنتی‌بیوتیک توسط سویه­های تولید کننده بیوفیلم هنوز به­طور کامل شناخته نشده است اما یکی از عوامل تولید گلیکوکالیکس در سلول­ها می­باشد که میتوانند از دفاع ایمنی میزبان و فعالیت آنتی‌بیوتیکها فرار کنند ]27[. به منظور از بین بردن سلول­های میکروبی تولید کننده بیوفیلم، ترکیبات آنتی‌بیوتیکی باید به ماترکس پلیساکاریدی نفوذ کنند تا به سلول برسند. علم نانوتکنولوژی با استفاده از نانوذرات می­تواند به معضل پاسخ دهد، به­طوری که یکی از نانوذرات فلزی، نانوذرات نقره می­باشد که مطالعات مختلفی به اثرات ضد میکروبی آن اشاره کرده­اند ]28[.
تاکنون از عصاره گیاهان مختلفی جهت سنتز نانوذرات نقره استفاده شده است. Mousavi و همکارانش با استفاده از عصاره گیاه Artemisia turcomanica نانو­ذرات نقره را سنتز کردند. نتایج این مطالعه نشان داد که نانوذره سنتز شده دارای میانگین اندازه 22 نانومتر بوده و دارای خاصیت ضدمیکروبی معناداری می‌باشد ]29[.Ghanbar  و همکارانش نانوذرات نقره را با استفاده از عصاره گیاه Artemisia quttensis podlech سنتز کردند. این محققان اثرات ضد باکتریایی را با روش میکرودایلوشن مورد مطالعه قرار دادند و نتایج این مطالعه نشان داد که نانوذره نقره دارای خاصیت ضدباکتریایی می‌باشد ]30[. هم­چنین Khanna P و همکارانش با استفاده از عصاره جلبک سیانوفیسه نانوذرات نقره را سنتز نموده و ذراتی با اندازه میانگین بین 100-20 نانومتر به‌دست آوردند ]31[. نتایج مطالعه ما نشان داد که نانوذرات نقره سنتز شده کروی و دارای اندازه میانگین 41/30 نانومتر می‌باشد. یکی از دلایل اختلاف در اندازه نانوذرات نقره سنتز شده در مطالعات مختلف به دلیل محتوای ترکیبات احیاء کننده عصاره­های گیاهی مختلف و هم­چنین شرایط واکنش مختلف می‌باشد.
در ادامه مطالعه، به دنبال جداسازی سویه­های کلبسیلا پنومونیه مولد بیوفیلم، اثرات ضد میکروبی و ضد­ بیوفیلمی‌ نانوذرات نقره مورد مطالعه قرار گرفت. نتایج تستهای ضد میکروبی نشان داد که نانوذرات نقره دارای اثرات ضدمیکروبی بر روی تمامی سویه­های مولد بیوفیلم داشت به طوری­که نانوذرات نقره سنتز شده از غلظت 25/6 تا 100 میکروگرم در میلی‌لیتر خاصیت میکروب کشی داشتند. همچنین، نتایج تست ضد بیوفیلمی‌توسط روش Real Time PCR نانوذرات نقره نشان داد که هنگامی‌که سویه­ها تحت تأثیر نانوذرات نقره در غلظت زیر حد مهارکنندگی قرار می‌گیرند، توانایی تشکیل بیوفیلم را ندارند. بنابراین هنگامی‌که سویه­ها در مجاورت نانوذرات نقره قرار می­گیرند، تولید اگروپلیساکارید در این سویه­ها ممانعت می‌شود و ارگانیسم نمی­تواند بیوفیلم تشکیل دهد. مکانیسم اصلی تأثیر نانوذرات نقره بر روی سویه­های کلبسیلا پنومونیه از طریق آسیب به DNA، پروتئین و تخریب دیواره سلولی میباشد ]32[. مطالعات نشان داده است که نانوذرات نقره رفتار فوتوکاتالیستی دارند و می‌توانند رادیکالهای سمی‌اکسیژن تولید کنند و منجر به از بین رفتن غشای سلول باکتریایی شوند در واقع نانوذرات یکپارچگی غشای سلول باکتری را مختل نموده و باعث کاهش سطح آب­گریزی سلول می‌شود و تنطیم رونویسی از ژنهای مقاومت در برابر استرس اکسیداتیو را کاهش می­دهد ]33[.
Moteriya و همکارانش نشان دادند که نانوذرات نقره سنتز شده توسط عصاره گیاه Caesalpinia pulcherrima که دارای اندازه 8 نانومتر بودند، دارای اثرات ضد میکروبی و ضد بیوفیلمی معنی­داری علیه باکتری­های استافیلوکوکوس اورئوس، سودوموناس آئروژینوزا و سالمونلا تایفی موریوم می‌باشد، به­طوری­که هر یک از سویه­ها دارای میزان MIC متفاوتی بودند که میزان MIC آن با نتایج مطالعه ما هم‌خوانی نداشت ]34[. تفاوت میزان MIC در مطالعات مختلف ممکن است به دلیل تفاوت در روش­های آماده‌سازی نانوذرات، اندازه نانوذره و تفاوت در سوشهای باکتریایی مورد مطالعه باشد. حساسیت باکتری­ها به نانوذرات فقط به ساختار دیواره سلولی مربوط نمی­شود، بلکه ممکن است به پراکسیداسیون چربی و تولید گونه­های فعال اکسیژن نیز مربوط باشد.
نتایج مشابهی توسط Kalishwaralal و همکارانش گزارش شد، به­طوری­که این محققان نشان دادند که در غلظت 100 نانومولار نانوذرات نقره سویه­های سودوموناس آئروژینوزا و استافیلوکوکوس اورئوس تا 95 درصد توانایی تشکیل بیوفیلم را از دست می­دهند ]35[. Moulavi P و همکارانش، اثرات نانوذرات نقره سنتز شده توسط عصاره گیاه درمنه را بروی بیوفیلم سویه­های استافیلوکوکوس اورئوس و بیان ژن­های بیوفیلم مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که نانوذرات نقره سنتز شده دارای اندازه میانگین زیر 100 نانومتر می‌باشند و نانوذرات نقره باعث مهار تشکیل بیوفیلم شده و بیان ژنهای icaA و icaR را در سویه­های استافیلوکوکوس اورئوس کاهش می‌دهند ]36[. Rajivgandhi G و همکارانش، اثرات ضد بیوفیلمی‌ نانوذرات نقره سنتز شده را در سویه­های استافیلوکوکوس اورئوس مورد مطالعه قرار دادند. نتایج این مطالعه نشان داد که نانوذرات نقره سنتز شده دارای اندازه میانگین 20 تا 50 نانومتر بوده و دارای اثرات ضد بیوفیلمی ‌می‌باشد و گزارش کردند که این نانوذرات می‌توانند جایگزین ترکیبات ضدبیوفیلمی دیگر باشند ]37[. نقطه نظر تمامی‌این مطالعات با مطالعه ما، اثرات ضد بیوفیلمی‌ نانوذرات نقره می­باشد اما نقطه نظر متفاوت، میزان درصد تشکیل بیوفیلم و میزان کاهش بیان ژن mrkA میباشد. یکی از دلایل این تفاوت می­تواند به دلیل مصرف بی رویه آنتی­بیوتیک­ها در کشورهای مختلف می­باشد که موجب ایجاد مقاومت به آنتی­بیوتیک­های مختلف و هم­چنین ظهور مکانیسم­های جدید مقاومت از جمله بیوفیلم می‌باشد و میزان بیان ژن بیوفیلم (mrkA) در سویه­های مختلف که تحت تأثیر نانوذرات نقره قرار می­گیرند متفاوت است، چون میزان تشکیل بیوفیلم به دلیل میزان متفاوت بیان ژن mrkA در سویه­ها متفاوت می‌باشد.
یکی دیگر از اهداف مطالعه حاضر تعیین تأثیر نانوذرات نقره بر بیان ژن تولید کننده بیوفیلم mrkA در سویه­های کلبسیلا پنومونیه بود. نتایج این مطالعه نشان داد که نانوذرات نقره در تمامی‌سویه­ها باعث کاهش بیان ژن معنی­دار در تمامی‌سویه­های مولد بیوفیلم شدند و بنابراین می­توانند باعث مهار تشکیل بیوفیلم شوند. با توجه به مهار بیان ژن بیوفیلم می­توان نتیجه گرفت که نانوذرات نقره می­توانند باعث مهار بیان ژن تولید کننده بیوفیلم شده و بنابراین نانوذرات نقره کاندید مناسبی جهت از بین بردن بیوفیلم در سویه­های کلبسیلا پنومونیه باشد. مطالعات مختلفی در مورد بررسی اثرات ضدبیوفیلمی نانوذرات نقره به انجام رسیده است. Loo و همکارانش اثرات ضد بیوفیلمی نانوذرات نقره را برروی بیوفیلم سویه­های سودوموناس آئروژینوزا مورد مطالعه قرار دادند. نتایج نشان داد که نانوذرات با اندازه کوچک بر روی بیوفیلم کلنی­های سودوموناس آئروژینوزا به میزان 90 درصد مؤثر است ]38[ و بنابراین وجه اشتراک تمامی مطالعات با مطالعه ما اثرات ضد بیوفیلمی‌معنی‌دار نانوذرات نقره می‌باشد. 
یکی از محدودیت­های این مطالعه، محدود بودن تعداد سویه­های کلبسیلا پنومونیه مقاوم به دارو و تشکیل دهنده بیوفیلم می­باشد، به همین دلیل پیشنهاد می­شود که در مطالعات آتی از تعداد سویه­های بیشتر مقاوم به دارو کلبسیلا پنومونیه که از نقاط مختلف جغرافیایی جداسازی شدهاند استفاده شود تا میزان بیان ژن mrkA در سویه­های مختلف بررسی شود. هم­چنین می­توان میزان اثرات ضد میکروبی و ضد بیوفیلمی‌نانوذرات نقره سنتز شده در این مطالعه را با نانوذرات تجاری مقایسه نمود.
نتایج این مطالعه اثرات ضد میکروبی و ضد بیوفیلمی‌نانوذرات نقره علیه سویه­های کلبسیلا پنومونیه را نشان داد. از آن­جایی­که مطالعات کمی‌در مورد تأثیر نانوذرات نقره بر روی بیوفیلم سویه های کلبسیلا پنومونیه انجام گرفته است، با توجه به اهمیت بالینی این باکتری، بتوان در آینده با انجام مطالعات تکمیلی احتمالاً بتوان از این ترکیب برای مهار بیوفیلم استفاده نمود.
تشکر و قدردانی
این مقاله منتهج از پایاننامه کارشناسی ارشد دانشگاه آزاد اسلامی واحد تهران مرکزی می­باشد، لذا محققان برخود لازم میدانند که از معاونت محترم پژوهشی به دلیل فراهم نمودن اعتبار مالی و همچنین از کلیه پرسنل آزمایشگاه میکروب شناسی که جهت فراهم نمودن سویه­های باکتریایی کلبسیلا پنومونیه همکاری نمودند، تشکر و قدردانی نمایند.
 
 
References
 
 
 
[1] Li BWebster TJ. Bacteria antibiotic resistance: New challenges and opportunities for implant-associatedorthopedic infections. J Orthop Res 2018; 36(1): 22-32.
[2] Gupta M, Didwal G, Bansal S, Kaushal K, Batra N, Gautam V, Ray P. Antibiotic-resistant Enterobacteriaceae in healthy gut flora: A report from north Indian semiurban community. Indian J Med Res 2019; 149(2): 276-80.
[3] Wyres KL, Wick RR, Judd LM, Froumine R, Tokolyi A, Gorrie CL, et al. Distinct evolutionary dynamics of horizontal gene transfer in drug resistant and virulent clones of Klebsiella pneumoniae. PLoS Genet 2019; 15(4): e1008114. 
[4] Juan CH, Chuang C, Chen CH, Li L, Lin YT. Clinical characteristics, antimicrobial resistance and capsular types of community-acquired, healthcare-associated, and nosocomial Klebsiella Pneumoniae bacteremia. Antimicrob Resist Infect Control 2019; 8(1): 12-23.
  1. Gautam V, Thakur A, Sharma M, Singh A, Bansal S, Sharma A, et al. Molecular characterization of extended-spectrum β-lactamases among clinical isolates of Escherichia coli & Klebsiella pneumoniae: A multi-centric study from tertiary care hospitals in India. Indian J Med Res 2019; 149(2): 208-15.
  2. Caliskan E, Say Coskun US, Dulger G, Kilincel O, Ankarali H, Sahin I. Investigation of plasmid mediated AmpC beta-lactamases in Escherichia coli and Klebsiella pneumoniae isolates by phenotypic and genotypic. J Pak Med Assoc 2019; 69(6): 834-39.
[7] Singh AK, Yadav S, Chauhan BS, Nandy N, Singh R, Neogi K, et al. Classification of clinical Isolates of Klebsiella pneumoniae based on their in vitro biofilm forming capabilities and elucidation of the biofilm matrix chemistry with special reference to the protein content. Front Microbiol 2019; 10(1): 669-78.
  1. Mohammadi M, Masoumipour F, Hassanshahian M, Jafarinasab T. Study the antibacterial and antibiofilm activity of Carum copticum against antibiotic-resistant bacteria in planktonic and biofilm forms. Microb Pathog 2019; 129 (2): 99-105.
[9] Türkel İ, Yıldırım T, Yazgan B, Bilgin M, Başbulut E. Relationship between antibiotic resistance, efflux pumps, and biofilm formation in extended-spectrum β-lactamase producing Klebsiella pneumoniae. J Chemother 2018; 30(6-8): 354-63.
[10] Alcántar-Curiel MD, Ledezma-Escalante CA, Jarillo-Quijada MD, Gayosso-Vázquez C, Morfín-Otero R, Rodríguez-Noriega E, et al. Association of antibiotic resistance, cell adherence, and biofilm production with the endemicity of nosocomial Klebsiella pneumoniae. Biomed Res Int 2018; 2018: 7012958.
  1. Jamil B, Habib H, Abbasi SA, Ihsan A, Nasir H, Imran M. Development of cefotaxime impregnated chitosan as nano-antibiotics: De Novo strategy to combat biofilm forming multi-drug resistant pathogens. Front Microbiol 2016; 7(1): 330-41.
[12] Cardoso MH, Santos VPM, Costa BO, Buccini DF, Rezende SB, Porto WF, et al. A short peptide with selective anti-biofilm activity against Pseudomonas aeruginosa and Klebsiella pneumoniae carbapenemase-producing bacteria. Microb Pathog 2019; 103605.
[13] Salomoni R, Léo P, Montemor AFRinaldi BG, Rodrigues M. Antibacterial effect of silver nanoparticles in Pseudomonas aeruginosa. Nanotechnol Sci Appl 2017; 10: 115-21
  1. Martinez-Gutierrez FBoegli LAgostinho ASánchez EMBach HRuiz Fet al. Anti-biofilm activity of silver nanoparticles against different microorganisms. Biofouling 2013; 29(6): 651-60.
  2. Iravani SKorbekandi HMirmohammadi SVZolfaghari B. Synthesis of silver nanoparticles: chemical, physical and biological methods. Res Pharm Sci 2014;9(6):385-406.
  3. Poulose SPanda TNair PPThéodore T. Biosynthesis of silver nanoparticles. J Nanosci Nanotechnol 2014; 14(2): 2038-49.
  4. Baharara J, Namvar F, Ramezani T, Mousavi MMohamad R. Silver nanoparticles biosynthesized using Achillea biebersteinii flower extract: apoptosis induction in MCF-7 cells via caspase activation and regulation of Bax and Bcl-2 gene expression. Molecules 2015; 20(2): 693-706.
  5. Angiosperm phylogeny group. "An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV". Botanical Journal of the Linnean Society 2016; 181(1): 1–20.
  6. Hansen DSAucken HMAbiola TPodschun R. Recommended test panel for differentiation of Klebsiella species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests. J Clin Microbiol 2004; 42(8): 3665-9.
  7. Clinical and laboratory standards institute (CLSI). Performance standards for antimicrobial susceptibility testing; 16th informational supplement. CLSI, Wayne, Pa. M100-S16, 26, no. 3.2018.
  8. Vuotto CLongo FPascolini CDonelli GBalice MPLibori MF. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 2017; 123(4): 1003-18.
  9. Erdogan OAbbak MDemirbolat GMBirtekocak FAksel MPasa Set al. Green synthesis of silver nanoparticles via Cynara scolymus leaf extracts: The characterization, anticancer potential with photodynamic therapy in MCF7 cells. PLoS One 2019; 14(6): e0216496.
  10. Fard NN, Noorbazargan H, Mirzaie A, Hedayati Ch M, Moghimiyan Z, Rahimi A. Biogenic synthesis of AgNPs using Artemisia oliveriana extract and their biological activities for an effective treatment of lung cancer. Artif Cells Nanomed Biotechnol 2018; 46(sup3): S1047-S1058.
  11. Vuotto CLongo FPascolini CDonelli GBalice MPLibori MF. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 2017; 123(4): 1003-18.
  12. Alkhudhairy MK, Alshadeedi SMJ, Mahmood SS, Al-Bustan SA, Ghasemian A. Comparison of adhesion genes expression among Klebsiella oxytoca ESBL-non-producers in planktonic and biofilm mode of growth, and imipenem sublethal exposure. Microb Pathog 2019; 134(1): 103558.
  13. Wood TK. Insights on Escherichia coli biofilm formation and inhibition from whole-transcriptome profiling. Environ Microbiol 2009; 11(1): 1-15.
  14. Singh SSingh SKChowdhury ISingh R. Understanding the mechanism of bacterial biofilms resistance to antimicrobial agents. Open Microbiol J 2017; 11(1): 53-62.
  15. Stewart PS. Mechanisms of antibiotic resistance in bacterial biofilms. Int J Med Microbiol 2002; 292(2): 107-13.
  16. Mousavi B, Tafvizi F, Zaker Bostanabad S. Green synthesis of silver nanoparticles using Artemisia turcomanica leaf extract and the study of anti-cancer effect and apoptosis induction on gastric cancer cell line (AGS). Artif Cells Nanomed Biotechnol 2018; 46(sup1): 499-510. 
  17. Ghanbar FMirzaie AAshrafi FNoorbazargan HDalirsaber Jalali MSalehi Set al. Antioxidant, antibacterial and anticancer properties of phyto-synthesised Artemisia quttensis Podlech extract mediated AgNPs. IET Nanobiotechnol 2017; 11(4): 485-92.
  18. Khanna PKaur AGoyal D. Algae-based metallic nanoparticles: Synthesis, characterization and applications. J Microbiol Methods 2019; 105656.
  19. Qing YCheng LLi RLiu GZhang YTang X, et al. Potential antibacterial mechanism of silver nanoparticles and the optimization of orthopedic implants by advanced modification technologies. Int J Nanomedicine 2018; 13: 3311-27. 
  20. Cao HLiu X. Silver nanoparticles-modified films versus biomedical device-associated infections. Wiley Interdiscip Rev Nanomed Nanobiotechnol 2010; 2(6):670-84
  21. MoteriyaP.Biosynthesis of silver nanoparticles formation from Caesalpinia pulcherrima stem metabolites and their broad spectrum biological activities. J Genet Eng Biotechnol 2018; 16(1): 105–13.
  22. Kalishwaralal KBarath Mani Kanth SPandian SRDeepak VGurunathan S. Silver nanoparticles impede the biofilm formation by Pseudomonas aeruginosa and Staphylococcus epidermidis. Colloids Surf B Biointerfaces 2010; 79(2): 340-4. 
  23. Moulavi P, Noorbazargan H, Dolatabadi A, Foroohimanjili F, Tavakoli Z, Mirzazadeh S, et al. Antibiofilm effect of green engineered silver nanoparticles fabricated from Artemisia scoporia extract on the expression of icaA and icaR genes against multidrug-resistant Staphylococcus aureus. J Basic Microbiol 2019: 29.
  24. Rajivgandhi G, Maruthupandy M, Muneeswaran T, Anand M, Quero F, Manoharan N, Li WJ. Biosynthesized silver nanoparticles for inhibition of antibacterial resistance and biofilm formation of methicillin-resistant coagulase negative Staphylococci. Bioorg Chem 2019; 89:103008.
[38] Loo CY1, Young PMCavaliere RWhitchurch CBLee WHRohanizadeh R. Silver nanoparticles enhance Pseudomonas aeruginosa PAO1 biofilm detachment. Drug Dev Ind Pharm 2014; 40(6):719-29.

Anti-biofilm [j1] Activity of Synthesized Silver Nanoparticles Using Asphodelus dendroides Extract against Antibiotic Resistant and Biofilm Forming Klebsiella pneumoniae Clinical Strains: A Laboratory Study
 
M. Sabahi[4], S. M. M. Hamdi[5], A. Mirzaie[6]
 
 
Received: 30/06/2019  Sent for Revision: 30/07/2019 Received Revised Manuscript: 09/11/2019 Accepted:  30/11/2019
 
Background and Objectives: Synthesis of silver nanoparticles (AgNPs) using plant extract is cost effective, while, one of the applications of AgNPs is its antimicrobial and anti-biofilm activities. The aim of this study was to investigate the anti-biofilm activity of synthesized AgNPs using A. dendroides against antibiotic resistant and biofilm forming clinical isolates of Klebsiella pneumoniae.
Materials and Methods: In this laboratory study, the AgNPs were first synthesized using Asphodelus dendroides extract and their size and structural characteristics were determined using various physico-chemical methods. Subsequently, the antimicrobial and anti-biofilm activities of synthesized AgNPs on antibiotic resistant and biofilm forming clinical isolates of K. pneumoniae were investigated via minimum inhibitory concentration (MIC) and Real Time PCR, respectively.
Results: The results of the UV-vis test showed that the synthesized AgNPs had a maximum absorbance at 420 nm. The SEM (scanning electron microscope), TEM (transmission electron microscopy) and XRD (X-ray powder diffraction) results showed that the synthesized AgNPs had a spherical structure with a mean size of 30.41±22 nm. Also, AgNPs had significant antimicrobial and anti-biofilm activities against K. pneumoniae strains, so that the AgNPs down-regulated the expression of biofilm coding gene (mrkA) in K. pneumonia strains (p<0.001).
Conclusion: The results of this study showed the antimicrobial and anti-biofilm activities of AgNPs against K. pneumoniae strains. According to the results, with further studies, the synthesized AgNPs may be used as biofilm inhibitors in future. 
Key words: Silver nanoparticle, Klebsiella pneumoniae, Antibacterial activity, Anti-biofilm activity, mrkA gene
 
Funding: This research was funded by Islamic Azad University, Central Tehran Branch.
Conflict of interest: None declared.
Ethical approval: The Ethical Committee of Islamic Azad University of Central Branch approved the study (IR.IAU, Tehran.REC.1397.019)
 
How to cite this article: Sabahi M, Hamdi S M M, Mirzaie A. Anti-biofilm Activity of Synthesized Silver Nanoparticles Using Asphodelus dendroides Extract Against Antibiotic Resistant and Biofilm Forming Klebsiella pneumoniae Clinical Strains: A Laboratory Study. J Rafsanjan Univ Med Sci 2020; 18 (12): 1233-52 [Farsi]
 
 
[1]- کارشناس ارشد، گروه زیست شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران
[2]- (نویسنده مسئول) دانشیار، گروه زیست شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران
تلفن: 88074907-021، دورنگار: 88074907-021، پست الکترونیکی: m.hamdi@iauctb.ac.ir
[3]- استادیار، گروه زیست شناسی، واحد رودهن، دانشگاه آزاد اسلامی، رودهن، ایران
 
[4]- MSc, Dept. of Biology, Islamic Azad University, Central Tehran Branch, Tehran, Iran, ORCID: 0000-0002-8214-6315
[5]- Associate Prof., Dept. of Biology, Islamic Azad University, Central Tehran Branch, Tehran, Iran, ORCID: 0000-0001-7167-1352
(Corresponding Author): Tel: (021) 88074907, Fax: (021) 88074907, E-mail: m.hamdi@iauctb.ac.ir
[6]- Assistant Prof., Dept. of Biology, Islamic Azad University, Roudehen Branch, Roudehen, Iran, ORCID: 0000-0002-0941-7828

 [j1]سربرگ اضافه گردد.
نوع مطالعه: پژوهشي | موضوع مقاله: زيست شناسي
دریافت: 1398/4/5 | پذیرش: 1398/9/9 | انتشار: 1399/1/1

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2024 CC BY-NC 4.0 | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb