جلد 20، شماره 4 - ( 4-1400 )                   جلد 20 شماره 4 صفحات 371-386 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Bolboli L, Khajehlandi M. The Effect of Six Weeks of Moderate-Intensity Endurance Training on Serum Levels of Klotho and Expression of the Fibroblast-23 Growth Factor Gene (FGF23) in the Hearts of Diabetic Rats: An Experimental Study. JRUMS. 2021; 20 (4) :371-386
URL: http://journal.rums.ac.ir/article-1-5915-fa.html
بلبلی لطفعلی، خواجه لندی مژده. تأثیر شش هفته تمرین استقامتی با شدت متوسط بر میزان سرمی Klotho و بیان ژن FGF23 در قلب موش‌های صحرایی دیابتی شده: یک مطالعه تجربی. مجله دانشگاه علوم پزشکی رفسنجان. 1400; 20 (4) :371-386

URL: http://journal.rums.ac.ir/article-1-5915-fa.html


دانشگاه محقق اردبیلی
متن کامل [PDF 362 kb]   (148 دریافت)     |   چکیده (HTML)  (243 مشاهده)
متن کامل:   (98 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 20، تیر 1400، 386-371
 
تأثیر شش هفته تمرین استقامتی با شدت متوسط بر میزان سرمی Klotho و بیان ژن FGF23 در قلب موش­های صحرایی دیابتی شده: یک مطالعه تجربی
 
 
لطفعلی بلبلی[1]، مژده خواجه لندی[2]
 
 
دریافت مقاله: 08/01/1400 ارسال مقاله به نویسنده جهت اصلاح: 04/02/1400 دریافت اصلاحیه از نویسنده: 25/02/1400       پذیرش مقاله: 26/02/1400
 
 
 
 
چکیده
زمینه و هدف: بیماران دیابتی مستعد درگیری­های قلبی-عروقی هستند. از این­رو هدف از مطالعه حاضر تعیین تأثیر شش هفته تمرین استقامتی با شدت متوسط بر میزان سرمی کلوتو (Klotho) و بیان ژن فاکتور رشد فیبروبلاستی-23 ((Fibroblast-23 growth factor; FGF23 در قلب موش­های صحرایی دیابتی شده بود.
مواد و روش­ها: در این مطالعه تجربی، 21 سر موش صحرایی نر نژاد ویستار بالغ، به­طور تصادفی در سه گروه هفت­­تایی قرار گرفتند: گروه دیابت تمرین (DT)، گروه دیابت کنترل (DC) و گروه سالم کنترل (HC). حیوانات از طریق تزریق درون صفاقی استرپتوزوتوسین­ ((Streptozotocin: STZ دیابتی شدند. موش­ها شش هفته تمرین استقامتی با شدت متوسط به صورت فزاینده انجام دادند. بررسی میزان سرمی Klotho به­روش روش الایزا بود و بیان ژن FGF23 در بافت قلب با استفاده از روش آزمایشگاهی  Real-time PCRصورت پذیرفت. داده­ها با آنالیز واریانس یک­طرفه و آزمون تعقیبی Scheffe آنالیز شدند.
یافته­ها: نتایج نشان داد که پس از شش هفته تمرین استقامتی، غلظت گلوکز خون (میلی­گرم بر دسی لیتر) در گروه DT نسبت به گروه DC به صورت معنی‌داری پایین­تر است (001/0p=) و میزان سرمی Klotho (نانوگرم بر میلی­لیتر) این گروه در مقایسه با گروه DC افزایش معنی‌دار یافته است (032/0p=)، اما میزان بیان ژن FGF23 به­طور نسبی در گروه DT در مقایسه با گروه DC تفاوت معنی‌داری نداشت (171/0p=).
نتیجه‏گیری: نتایج نشان داد تمرینات استقامتی با شدت متوسط بر میزان سرمی Klotho و کنترل قند خون موش­های دیابتی تأثیر مثبتی دارد و به­نظر می­رسد تا حدودی محافظ عملکرد قلبی باشد.
واژه­های کلیدی: Klotho، FGF23، تمرین استقامتی، دیابت، قلب، موش صحرایی
 
 
 
 
مقدمه
دیابـت شـیرین (Diabetes Mellitus) از جمله بیمـاریهـای متابولیک می­باشد که مشخصه­ اصلی آن افزایش مـزمن در میزان سطوح قنـد خـون و درنتیجه­ آن، ایجاد اختلال در متابولیسم کربوهیدرات، چربی و پروتئین می­باشد [2-1]. بدین ترتیب بیماران دیابتی در معرض خطر فشارخون بالا، آتروژنز، استرس اکسیداتیو، بیماری عروق کرونری و انفارکتوس قلبی قرار می­گیرند [5-3]. در نتیجه با افزایش استرس اکسیداتیو، تغییرات هورمونی، میزان فعالیت آنزیم­ها، ساختار و عملکرد اندام­ها و پروتئین­های بافت­های مختلف از جمله بافت قلب دیده می­­شود ]4[. ازجمله پروتئین­هایی که تحت تأثیر بیماری دیابت و عوارض ناشی از آن قرار می­گیرند کلوتو (Klotho) و فاکتور رشدی فیبروبلاستی 23 (Fibroblast growth factor 23; FGF23)  است. براساس نتایج مطالعات حذف این ژن در موش­ها، باعث ایجاد تظاهرات مشابه فرایند افزایش سن مانند: تغییرات متابولیسم کلسیم-فسفات، کلسیفیکاسیون عروق و هم­چنین کاهش طول زندگی آن­ها شده است [6].
در پژوهش­های مختلف صورت گرفته بر روی Klotho، کاهش آن با افزایش سن و در بیماری­های دیابت، بیماری پرفشاری خون، نارسایی مزمن کلیوی، ایسکمی کلیه و بیماری گلومرونفریت دیده شده است که با مهار نمودن رســـوب مواد معدنی، جذب فســـفات و تمایز ســـلول­های دیواره­ عروق ایفای عمل می­کند [8-7]. با کاهش Klotho، اختلالات عروقی تسریع می­شود و حاصل آن کلسیمی شدن عروق در بیماران مبتلا به بیمار مزمن کلیوی و دیابت است که یکی از عوامل اصلی مرگ و میر بر اثر اختلالات قلبی-عروقی زودرس می­باشد [10]. لذا، کلسیمی شدن عروق در مرحله­ی اول، به علت اختلال در روند هوموستاز ویتامین D و فسفات ناشی از کمبود Klotho بوده اســت [10]. پروتئین Klotho گیرنده­ مشترک و اجباریFGF23  بوده و کمبود کلوتوی عروقی به توسعه­ بیشتر کلسیمی شدن عروق انســــان منجر میشـــود و مقاومت به FGF23 را میانجی­گری می­کند [11]. خود پروتئین FGF23 یکی از اعضای خانواده FGFها است که سطوح کلسیم و فسفات سرمی را کاهش می­دهد و به­طور منفی ساختار و عملکرد قلب را تحت تأثیر قرار می­دهد و منجر به القای کانسنتریک هایپرتروفیک می­گردد. در واقع افزایش در غلظت FGF23 از طریق تأثیر مستقیم بر دهلیز میوکارد باعث فیبریلاسیون دهلیزی می­شود که عامل قوی و تعیین کننده­ آن مقدار سطوح فسفات سرمی است [13-12]. در مجموع باید بیان نمود که سطوح کلســیم و فســفات با FGF23 تنظیم می­شود [14]. میزان FGF23 در بیماری دیابت افزایش پیدا می­کند و افزایش هایپرتروفی و تغییر در اندازه قلب در پاسخ به FGF23 باعث بالارفتن فشارهای بالای بطن چپ می­گردد. از طرفی اختلال در عملکرد بطن چپ نیز خود می­تواند منجر به افزایش سایز دهلیز چپ گردد که این خود عامل اصلی آریتمی بطنی است [17-15].
امروزه با توجه به ممنوعیت مصـــرف انواع داروها، عوارض جبرانناپذیر آن در افراد دیابتی و هم­چنین هزینه­ زیاد درمان این بیماران، فعالیت ورزشی به­عنوان یک ابزار راهبردی، کمهزینه و بدون عوارض جانبی جهت جلوگیری و کنترل بیماری­ها به خصوص بیماری دیابت توصیه شده است [18]. براساس برخی از تحقیقات صورت­گرفته این­گونه به­نظر میرسد که با اجرای فعالیت ورزشی بتوان میزان Klotho را کنترل کرد. چنان­چه نتایج پژوهش Najafipour و همکاران در مطالعه­ای روی رت­های دچار سکته قلبی شده نشان داد که اجرای فعالیت ورزشی با شدت متوسط باعث متعادل شدن سطوح Klotho گردیده است [19]. با این حال، در گزارش­های ناموفقی نیز، وجود هرگونه رابطه­ مستقیمی بین فعالیت ورزشی و سطح کلوتوی سرمی رد شده است [20]. برای پروتئین FGF23 نیز نتایج متناقضی در دسترس است، بهطوری­که در تحقیقی که به بررسی هشت هفته تمرین هوازی بر میزان ,Klotho FGF23 و کلسیم سرمی در زنان دیابتی یائسه صورت پذیرفت، تفاوت معنی‌داری در میزان FGF23 بین گروه کنترل و تمرین مشاهده نگردید [6]. این درحالی است که در مطالعات دیگری افزایش FGF23 متعاقب تمرین ورزشی نشان داده شده است [21].
بنابراین از آن­جایی­که براساس مطالعات مختلف نشان داده شده است تمرین استقامتی منظم به­منظور درمان نسبی بیماران دیابتی استفاده می­شود [22]، بافت قلبی نیز با قرارگیری طولانی مدت در برابر یک محرک ویژه مانند کاهش تغذیه، فعالیت بدنی و غیره می­تواند سازگاری پیدا کند و ظاهراً تمرینات طولانی­مدت بر عوامل بیوشیمیاییKlotho ، FGF23، کلسیم و نیز تعدیل غلظت محور Klotho-FGF23 مرتبط با سختی شریانی تأثیرگذار است [6]، به­علاوه وجود نتایج محدود و متناقض در ارتباط با انواع مختلف پروتکل­های ورزشی در رابطه با اثرگذاری یا عدم اثرگذاری بر Klotho و FGF23، هدف از مطالعه حاضر تعیین تأثیر شش هفته تمرین استقامتی با شدت متوسط بر میزان سرمی Klotho و بیان ژن FGF23 در قلب موش­های صحرایی نر نژاد ویستار تجربی بود.
مواد و روش­ها
تحقیق حاضر از نوع تجربی است و دارای کد کمیته اخلاق پژوهش بر حیوانات به شماره IR.ARUMS.REC.1398.251 است. تعداد 21 سر موش صحرایی نر بالغ نژادWistar  به­عنوان نمونه درنظر گرفته شدند. کلیه­ حیوانات در شرایط کنترل شده محیطی با میانگین دمای 3±22 درجه سانتی گراد، رطوبت 5±50 درصد و چرخه روشنایی-تاریکی 12:12 ساعت در مرکز نگه­داری از حیوانات دانشکده علوم پایه دانشگاه شهید چمران اهواز در سال 1398 نگه­داری گردیدند و دسترسی آزاد به آب و غذای ویژه موش داشتند.
القاء دیابت پس از 12 ساعت محرومیت از غذا، در 14 سر از موش­های صحرایی­ نر با یک­بار تزریق درون صفاقی استرپتوزوتوسین (Streptozotocin; STZ) با دوز  45 میلیگرم بر کیلوگرم محلول STZ STZ Sigma, St. Louis MO, USA)) تهیه شده در بافر سیترات تازه 5/0 مولار با 5/4=pH صورت پذیرفت. به موش­های صحرایی‌ غیر دیابتی نیز معادل حجمیSTZ  بافر سیترات تزریق شد. 48 ساعت پس از تزریق، با ایجاد یک جراحت کوچک توسط لانست روی ورید آن­ها، یک قطره خون روی نوار گلوکومتر قرار داده شد و قند خون با استفاده از دستگاه گلوکومتری (روشه دیاگنوستیک ساخت کشور ژاپن) اندازه­گیری شد. موش­هایی که قند خون آن­ها بالاتر از 240 میلی­گرم بر دسی­گرم  بود، به­عنوان موش­های دیابتی در مطالعه حاضر مورد استفاده قرار گرفتند [23]. پس از آن حیوانات به­روش تصادفی به سه گروه مساوی هفت­تایی تقسیم شدند: 1) گروه دیابت تمرین (DT): این گروه شامل هفت سر موش صحرایی بود که از طریق تزریق درون صفاقی­ STZ دیابتی شدند و شش هفته فعالیت ورزشی روی نوارگردان داشتند، 2) گروه دیابت کنترل :(DC) این گروه شامل هفت سر موش صحرایی بود که از طریق تزریق درون صفاقی STZ دیابتی شده و در هیچ‌گونه برنامه تمرینی شرکت داده نشدند، 3) گروه سالم کنترل (HC): این گروه شامل هفت سر موش صحرایی سالم بود که درگیر هیچ فعالیتی نبودند.
در طول مرحله آشناسازی، موش­های گروه DT به مدت دو هفته با شرایط آزمایشگاه و نوارگردان مخصوص جوندگان آشنا شدند و پنج روز در هفته به مدت 15-10 دقیقه با سرعت 10 متر در دقیقه بر روی نوار گردان به منظور آشنا شدن با شرایط آزمایشگاه، راه رفتند [24].
در تحقیق حاضر تمرین استقامتی با شدت متوسط روی نوارگردان انجام گردید [24]. به­طوری­که گروه‌ تمرین استقامتی در معرض تمرین نوار گردان پنج جلسه در هفته و به­مدت زمان شش هفته تمرین قرار گرفتند. پروتکل به­صورتی بود که سرعت نوارگردان و مدت تمرین به­تدریج افزایش ‌مییافت این درحالی­ بود که شیب آن در کل پژوهش صفر درنظر گرفته­شد. روند افزایش یافتن سرعت و مدت درطول پژوهش بدین شرح بود: از 10 متر در دقیقه برای 10 دقیقه در هفته اول، 10 متر در دقیقه برای 20 دقیقه در هفته دوم، 15 متر در دقیقه برای 20 دقیقه در هفته سوم، 15 متر در دقیقه برای 30 دقیقه در هفته چهارم، به 18-17 متر در دقیقه برای 30 دقیقه در هفته پنجم افزایش یافت. جهت رسیدن به سازگاری‌های به­دست‌ آمده در حالت یکنواخت، تمامی متغیرهای تمرینی در هفته پایانی (هفته ششم) ثابت نگه‌داشته شدند. اندازه­گیری سطوح گلوکز قبل از شروع انجام پروتکل، در طول دوره­ تمرینی و پس از اتمام آن از انتها دم هر یک از حیوانات پس از 12 ساعت ناشتا توسط گلوکومتر گرفته شد. لازم به ذکر است که تعداد موش­های دیابتی 10 سر بود که سه سر از آن در حین پژوهش تلف گردید [24]. پروتکل تمرینی در جدول 1 به نمایش گذاشته شده است.
 

 
جدول 1- پروتکل تمرینی در طول شش هفته بر روی ­موش­های صحرایی دیابتی
 
متغیرهای پروتکل هفته اول هفته دوم هفته سوم هفته چهارم هفته پنجم هفته ششم
مدت تمرین (دقیقه) 10 20 20 30 30 30
سرعت نوارگردان (متر بر دقیقه) 10 10 15 15 18-17 18-17
شیب (درجه)
تکرار (روز در هفته)
0
5
0
5
0
5
0
5
0
5
0
5
 
 
24 ساعت پس از آخرین جلسه تمرین استقامتی حیوانات توسط تزریق درون صفاقی ترکیبی از 75 میلی­گرم بر کیلوگرم کتامین و پنج میلی­گرم بر کیلوگرم زایلازین بیهوش شدند. به­منظور جمع­آوری خون سرخرگی، با ثابت کردن حیوان روی تخته جراحی جوندگان خون­گیری مستقیم از بطن چپ حیوانات صورت پذیرفت، سپس خون گرفته­ شده در لوله­های آزمایش حاوی آپروتینین ریخته شد تا از تجزیه­ پروتئینی در آن جلوگیری شود. پس از 10 دقیقه قرار گرفتن در محیط آزمایشگاه به کمک سانتریفیوژ (28 کاناله مدل روتین 28، شرکت تولیدی تجهیزات پزشکی بهداد) سرم­ها جدا شد و بلافاصله در دمای منفی 70 درجه­ سانتیگراد نگه­داری شد. بررسی سطوح سرمی کلسیم توسط تست بیوشیمی اسپکتروفتومتریک با استفاده از کیت زیست شیمی صورت پذیرفت، برای اندازه­گیری سطوح سرمی Klotho از کیت آلمانی زلبایو و تست الایزا استفاده شد [25].
بیان ژن FGF23 نیز به­روش آزمایشگاهی Real-time PCR انجام گردید. تحت شرایط استریل بافت قلب توسط متخصص بافت برداری جدا شد و تازمان انجام بررسی­های آزمایشگاهی در دمای منفی70 نگه­داری شدند. استخراج RNA با استفاده از کیت تجاری TRIZOL و مطابق با روش ارائه شده توسط شرکت انجام شد. به­منظور حذفDNA ، تمام نمونه­های RNA به­مدت یک ساعت با آنزیم Dnase و مطابق روش ارائه شده توسط شرکت تیمار شدند. غلظت و میزان خلوص نمونه­های RNA  پس از قرائت جذب آن­ها در طول موج 260 نانومتر و نیز محاسبه نسبت جذب 280/260 با استفاده از اسپکتروفوتومتر بیوفتومتر (مدل دی تری، اپندورف آلمان) تعیین گردید. نمونه­هایی که نسبت جذب 280/260 آنها بیش از 8/1 بود. جهت سنتزcDNA  مورد استفاده قرار گرفتند. سنتز cDNA با استفاده از کیت تجاریAmpliSence  صورت پذیرفت. پرایمرهای تصادفی هگزامر در واکنش­هایی با حجم 20 میکرومول در لیتر مطابق دستورالعمل شرکت انجام شد. به منظور تأیید بیان ژن­های مورد نظر، ابتداء واکنش روی بافت­های مورد نظر انجام گردید و در صورت تأیید بیان ژنهای مورد نظر به منظور بررسی مقایسه­ای بیان ژن­ها از آزمون PCR در زمان حقیقی استفاده گردید. برای طراحی پروب و پرایمر از نرم افزارBeacon designer TM7/01  استفاده شد. واکنش­های PCR با استفاده از آنزیم Taq polymerase  در واکنش­هایی با حجم 25 میکرومول در لیتر انجام شد. نمونهcDNA  بافت قلب به عنوان کنترل مثبت و یک نمونه واکنش فاقد cDNA به­عنوان کنترل منفی در هر واکنش PCR در نظر گرفته شد. به­منظور مشاهده محصولPCR  از ژل آگاروز دو درصد تهیه شده در محلول بافر TAE استفاده شد. برای ارزیابی تغییرات در بیان ژن­ها روش مقایسه­ای 2-ΔΔCt و دستگاه Mini Option Tm محصول شرکت بیوراد و کیت تجاریqPCR Probe  Master Bioneer  استفاده شد. مقادیر مقایسه­ای بیان ژن­های مورد نظر در مقایسه با بیان GAPDH در هر بافت توسط نرم افزار ژن ارزیابی و بر اساس رابطه2-ΔΔCt  گزارش گردید [26]. توالی پرایمرها در جدول 2 به­ نمایش گذاشته شده است.
 
 
جدول 2- توالی پرایمرهای مورد استفاده در پژوهش
 
ژن­ها رفت برگشت
GAPDH AAGTTCAACGGCACAGTCAAGG CATACTCAGCACCAGCATCACC
FGF-23 GGAATGGATTGAGGGATGTGA GAGCAGTTTGGGTTTTTTGTAG
 
 
 
بـرای رسـم نمودارها از نرمافـزار اکسل (مایکروسافت آفیس 2010) اسـتفاده و داده­هـا بـه صـورت انحراف استاندارد ± میـانگین گزارش شده اسـت. داده­ها توسط نرم افزار SPSS نسخه 23 آنالیز شدند. برای تجزیه و تحلیل داده­ها به ترتیب از آمار توصیفی و آزمون استنباطی استفاده گردید به­صورتی­که از آزمون Shapiro-Wilk برای طبیعی بودن توزیع داده­ها و از آزمون Levene برای همگنی واریانس گروه­ها استفاده شد. از آنالیز واریانس یک­طرفه و آزمون تعقیبی Scheffe برای بررسی تغییرات قند خون، کلسیم، Klotho و FGF-23 در گروه­های مورد مطالعه استفاده گردید. سطح معنی‌داری در آزمون­ها 05/0 در نظر گرفته شد.
نتایج
نتایج آزمون Shapiro-Wilk و Levene نشان داد که تمام متغیرهای تحقیق دارای توزیع نرمال بوده و واریانس گروه­ها نیز همگن می­باشند (05/0<P). در شروع پروتکل تمرینی سطح گلوکز خون پس از القاء دیابت توسط STZ در موش‌های گروه­های دیابتی به صورت معنی‌داری افزایش یافت (001/0p=) و پس از شش هفته تمرین استقامتی در مقایسه با گروه سالم همچنان از اختلاف معنی‌داری برخوردار بود (001/0p=) و این افزایش در مدت زمان دوره تمرینی نیز ادامه داشت، اما باید بیان نمود که در پایان برنامه تمرینی، غلظت گلوکز خون (میلی­گرم بر دسی­لیتر) در گروه دیابت تمرین کرده نسبت به گروه دیابت کنترل به صورت معنی‌داری پایین­تر بود (001/0p=) (نمودار 1).
 
 

 
نمودار 1- نمایش سطوح سرمی گلوکز (میلی­گرم بر دسی­لیتر) ناشتا بر اساس میانگین و انحراف استاندارد در موش­های صحرایی گروه­های مختلف قبل از القاء دیابت، هفته سوم، هفته پنجم و بعد از اتمام پروتکل. حروف نامتشابه بیانگر وجود اختلاف آماری معنی‌دار در بین گروه ها می‌باشد (05/0p<)
 
 
در 3 شکل زیر،  باندهای بررسی بیان ژن­های FGF23 در 5 نمونه از گروه­های DT، DC و HC با روش RT-PCR به
نمایش گذاشته شده است.
 
 
M

شکل 1- باند بررسی بیان ژن FGF-23 در 5 نمونه از گروه دیابت تمرین با روش RT-PCR، M: مارکر (bp100)
M

شکل 2- باند بررسی بیان ژن FGF-23  در 5 نمونه از گروه دیابت کنترل با روش RT-PCR، M: مارکر (bp100)
M

شکل 3- باند بررسی بیان ژن FGF-23 در 5 نمونه از گروه سالم کنترل با روش RT-PCR، M: مارکر (bp100)
 
 
نتایج توصیفی و استنباطی این تحقیق درمورد فاکتورهای Klotho و FGF-23 در جداول 3 و 4 آورده شده است و مشخص گردیده است که بیماری دیابت تأثیر منفی بر هر دو فاکتور داشته است و باعث کاهش معنی‌دار (039/0p=) میزان سرمی Klotho (نانوگرم بر میلی­لیتر) و افزایش معنی‌دار­ (001/0P=) میزان بیان ژن (بیان نسبی) FGF-23 در گروه DC نسبت به HC گردیده است، اما پس از شش هفته تمرین استقامتی میزان Klotho در گروه DT نسبت­ به DC افزایش معنی‌دار (017/0p=) داشته است، اما برای میزان بیان ژن FGF-23 تفاوت معنی‌دار (171/0p=) در گروه DT نسبت بهDC  مشاهده نشد و سطوح آن در هر دو گروه دیابتی نسبت به گروه HC کاهش معنی‌داری داشت (05/0p<).
 
 
جدول 3- میانگین و انحراف استاندارد برای سطوح سرمی Klotho و بیان ژن FGF-23 در موش­های صحرایی
متغیر گروه­ها (7=n) میانگین انحراف استاندارد
Klotho دیابت تمرین 09/5 15/0
(نانوگرم بر میلی­لیتر) دیابت کنترل 25/3 20/0
  سالم کنترل 36/5 52/0
FGF-23 دیابت تمرین 09/1 05/0
(بیان نسبی) دیابت کنترل 16/1 04/0
  سالم کنترل 66/0 88/0
 
 
 
 
 
 
 
 
 جدول 4-  نتایج آزمون تحلیل واریانس یک­طرفه و آزمون تعقیبی Scheffe برای سطوح سرمی Klotho بیان ژن FGF-23
فاکتورها تحلیل واریانس
یک­طرفه
آزمون تعقیبی Klotho مقدار p
05/0>
آزمون تعقیبی FGF23 مقدار p
05/0>
Klotho HC DC 039/0# HC DC 001/0#
(نانوگرم بر میلی­لیتر) 017/0*   DT 796/0   DT 003/0#
    DC HC 039/0# DC HC 001/0#
FGF-23     DT 032/0#   DT 171/0
(بیان نسبی) 001/0* DT HC 796/0 DT HC 003/0#
      DC 032/0#   DC 171/0
 
*تفاوت معنی‌دار بین گروه DT، DC و با HC در نتیجه آزمون تحلیل واریانس یک­طرفه و # تفاوت معنی‌دار متغیرها به­صورت دو به دو بین گروه­ها بر اساس آزمون تعقیبی Scheffe. HC: سالم کنترل، DC: دیابت سالم و DT: دیابت کنترل می­باشد.
 
 
نتایج نشان داد که برای متغیر بیوشیمیایی کلسیم (میلیگرم بر دسی­لیتر) نیز تمرین هیچ­گونه اثر معنی‌داری بر آن نداشته است (05/0<p)، در حالی­که بیماری دیابت باعث کاهش سطوح سرمی آن گردیده است که در نمودار­ 2 به نمایش گذاشته شده است (05/0p<).
 
 

نمودار2- نمایش میزان سرمی کلسیم (میلی­گرم بر دسی­لیتر) بر اساس میانگین و انحراف استاندارد، پس از شش هفته تمرین استقامتی در موش­های گروه­های مختلف بر اساس آزمون تحلیل واریانس یک­­طرفه. حروف نامتشابه بیانگر وجود اختلاف آماری معنی‌دار در بین گروه­ها می‌باشد (05/0p<)
 
 
بحث
تحقیق حاضر با هدف تعیین تأثیر شش هفته تمرین استقامتی با شدت متوسط بر میزان سرمی Klotho و بیان ژن FGF23 در قلب موش­های صحرایی ویستار مبتلا به دیابت تجربی انجام پذیرفت. نتایج نشان داد که بیماری دیابت باعث کاهش میزان سرمی Klotho در موش­های دیابتی شده است [9] و تمرین استقامتی با شدت متوسط می­تواند باعث تغییر و تعادل سطوح آن گردد. کاهش Klotho در اثر بیماری دیابت می­تواند باعث اختلال در عملکرد گره سینوسی دهلیزی و تغییر در میزان آرتریواسکلروتیک گردد که اینها خود عواملی برای ایجاد فیبریلاسیون دهلیزی است [11]، چرا که براساس نتایج تحقیقات Klotho در فعالیت نرمال گره سینوسی و عملکرد کانال­های یونی مسئول، عاملی ضروری است [27]. بنابراین با اثرگذاری مثبت تمرین ورزشی با شدت متوسط بر سطوح آن در شرایط دیابت توجه به انجام فعالیت ورزشی بیشتر و شاید جدی­تر مورد توجه قرار خواهد گرفت. در تحقیق حاضر نیز خوشبختانه شاهد اثر مثبت تمرین استقامتی با شدت متوسط بر میزان سرمی Klotho موش­های دیابتی بودهایم و پس از شش هفته تمرین استقامتی میزان سرمی آن افزایش یافته است که همراستا با نتایج بسیاری از نتایج مطالعات است. ازجمله­ این مطالعات، پژوهشی بود که به بررسی تأثیر تمرینات تناوبی پر شدت بر میزان فیبریلاسیون دهلیزی، FGF23 و پروتئین Klotho در رت­های مبتلا به نارسایی کلیه پرداخته شد [28] و نتایج نشان داد که تمرین باعث افزایش میزان پروتئین Klotho شده است که همراستا با نتیجه پژوهش حاضر است. در واقع فعالیت ورزشی اثر مثبت خود را از طریق افزایش ظرفیت آنتی­اکسیدانی، تغییرات سازشی در میتوکندریایی قلبی، بهبود عملکرد کانال­های پتاسیمی وابسته به ATP و افزایش بیان پروتئین­های شوک گرمایی می­گذارد [30-29] و اثرگذاری Klotho نیز از طریق افزایش نیتریک اکساید (NO) است و از عملکرد اندوتلیال محافظت می­نماید که درنتیجه­ آن تنظیم ریتمیک عضلات اندوتلیال دیده می­گردد [31]. Klotho هم­چنین باعث کاهش استرس اکسیداتیو می­گردد که از طریق تأثیر بر مسیر Transforming growth factor beta; TGF-B)) صورت میپذیرد [33-32]. شایان ذکر است که عامل TGF-B خود یک عامل پیش فیبروزی است که مانع فعالیت سلولهای ماهواره­ای و تمایز میوبلاست نیز می­گردد [34] و Klotho می­تواند مانع فعالیت آن شود.
بیماری دیابت با خطر کاهش مواد معدنی استخوان و دفع ادراری کلسیم و فسفات همراه است و افزایش تحلیل استخوانی در این بیماران گزارش شده است [35]. اخیراً تحقیقات نشان داده­اند که Klotho اثر محافظتی خود بر قلب را از طریق تنظیم کانال­های TRPC6 اعمال می­کند که با مهار این کانال­ها از ورود کلسیم بالا به سلول­ها ممانعت می­کند و از این طریق از ایجاد فیبروز و اختلال در عملکرد قلبی محافظت می­کند [36]. همان­گونه که مشاهده گردید در تحقیق حاضر بر اثر بیماری دیابت سطوح سرمی کلسیم همراستا با سطوح Klotho کاهش یافت و سطوح سرمی آن تحت تأثیر بیماری دیابت قرار گرفت و تمرین نتوانست بر میزان سرمی آن تغییراتی را ایجاد کند. علاوه براین باید بیان نمود که وضعیت ساختاری و عملکردی شریان­ها بازتاب تأثیر عوامل خطر قلبی-عروقی است [19] و بر اثر بیماری دیابت سختی شریانی دیده می­گردد [37] که متأثر عواملی از قبیل Klotho و قند خون است. درواقع ارتباط سختی شریانی و کاهش سطح قند خون ناشتا وابسته به ساز و کار هموگلوبین گلیکوزیله است و از طرفی، در فعالیت هوازی Klotho افزایش می­یابد و بهبود سختی شریانی را از مسیرهای مختلفی میسر می­سازد [6]، در تحقیق حاضر نیز مشاهده گردید که با اثر تمرین استقامتی با شدت متوسط بر کنترل سطوح گلوکز خون و افزایش سطوح سرمی Klotho احتمالاً کاهش سختی شریانی هم پدیدار شده باشد.
از دیگر فاکتورهایی که پس از شش هفته تمرین استقامتی در موش­های دیابتی مورد بررسی قرار گرفت تعیین میزان بیان ژن FGF23 بوده است که تحت شرایط بیماری دیابت میزان بیان ژن آن افزایش پیدا کرده بود و تمرین تأثیر معنی‌داری بر تغییرات بیان ژن آن نداشته است هرچند تاحدودی کاهش در آن دیده شد که معنی‌دار نبود. نتیجه این تحقیق در زمینه بررسی نتیجه FGF23 با نتایج بسیاری از پژوهش­ها همسو است چرا که مشخص گردیده است این فاکتور به­سختی تحت تأثیر فعالیت بدنی قرار می­گیرد. چنان­چه در مطالعه­ Afkhamy ardakani که به بررسی اثر فعالیت هوازی هشت هفته­ای بر محور کلوتوFGF23- و کلسیمی شدن شریان در زنان یائسه و دیابتی نوع دو پرداخته بودند نتایج نشان داده عدم تغییر معنی‌داری در میزان FGF23 تحت تأثیر فعالیت بدنی بود [6] که با مطالعه حاضر همسو است. از طرف دیگر، در محدود پژوهش­های صورت گرفته شده این فاکتور تغییر سطوح داده است، به­عنوان مثال در تحقیق Li و همکارانش سطوح FGF23 متعاقب فعالیت ورزشی در موش­ها افزایش پیداکرده است [21]. در کل، دلایل مختلفی در ناهمسویی تحقیقات دخیل هستند که ازجمله­ آن­ها تفاوت در پروتکل برنامه­ تمرینی، شدت و حجم و نوع آزمودنی­ها میتواند باشد [18].
در مطالعه Li نیز شاید دلیل افزایش FGF23 فعالیت ورزشی کوتاه مدت، درمانده ساز و یک­هفته­ای بوده است چرا که افزایش FGF23 یک پاسخ کوتاه مدت به فعالیت ورزشی است [21]. ســـازوکارهای متعددی وجود دارد که نشان دهنده نقش منفی ازدیاد­ FGF23 در بیمــاری­هــای قلبی-عروقی است. یکی از ساز و کارهای احتمالی FGF23، مشارکت آن در فرایند پیچیده­ کلسیمی شدن عروقی است. بیان گردیده است که ســطح بالایی از ­ FGF23منجر به کمبود Klotho می­شــود [6] و FGF23 باعث افزایش جذب مجدد ســــدیم کلیه می­شـــود، بنابراین باعث پرفشــاری خون و هایپرتروفی قلبی می­شــود [38]. همچنین بیان گردیده است که FGF23 در تحریک تولید مولکول­های چسبان V-cam1 و E-selectin نقش دارد که این خود باعث عملکرد غیر طبیعی اندوتلیال عروق می­گردد [39]. اعتقاد بر این است که در شرایط طبیعی و غیرآزمایشگاهی گیرنده­  FGF3میانجی اصــلی تأثیرات FGF23 اســت. ظاهراً Klotho به FGF23 اجازه می­دهد با تمایل بیشتری نسبت به زمانی که به تنهایی عمل می­کند به گیرنده­اش متصل گردد. به این ترتیب مانع از رسوب کلسیم ماتریکس شود [9-6]. به­علاوه FGF23 در حضــور Klotho پیام­های پایین­دســتی را فعال می­کند، از جمله فعال­ســازی عناصــر پاســخ رشــدی زودرس (Egr_1)  و فسفوریله شدن سوبسترای α2 گیرنده­ FGF، کینازهای تنظیم کننده­ خارج ســلولی، P38، کینازهای پایانه­های(junk)c jun_NHz  و پروتئین­های AKT می­باشد. این مشـــاهدات نشـــان میدهد که تعامل FGF23 و گیرنده­اش و فعالیت پیام­رسانی پس از آن به کوفاکتور Klotho نیاز دارد [9].
از جمله محدودیت­های پژوهش پیش­رو عدم ارزیابی سایر عوامل درگیر در پروسه سختی شریانی و عدم اندازه­گیری سطوح پروتئینی دو فاکتور Klotho و FGF23 می­باشد. بنابراین، با توجه به این­که در پژوهش حاضر تنها دو فاکتور مربوط به عوامل درگیر در پروسه سختی شریانی بررسی شده است، پیشنهاد می­گردد در تحقیقات آینده دیگر فاکتورهای مرتبط نیز اندازه­گیری شوند.
نتیجهگیری
به­طور کلی براساس یافته­های پژوهش حاضر مبنی بر کنترل سطوح گلوکز خون، افزایش سطوح سرمی Klotho در نتیجه تمرین استقامتی با شدت متوسط می­توان بیان نمود که ظاهراً این نوع تمرین می­تواند در کنترل سختی شریان بیماران دیابتی نقش مؤثری داشته باشد، هرچند برای اظهار نظر قطعی نیاز به انجام پژوهش­های بیشتری وجود دارد.
تشکر و قدردانی
این مقاله برگرفته از طرح پژوهشی گروه فیزیولوژی ورزشی دانشکده علوم تربیتی و روان­شناسی دانشگاه محقق اردبیلی است. نویسندگان مقاله از معاونت پژوهشی آن دانشگاه به­دلیل حمایت مالی این پژوهش تشکر و قدرانی می­کنند.
 
 
 
References
 
 
 
[1] Cho SMJ, Lee H, Shim J S, Kim H C. Association of snoring with prediabetes and type 2 diabetes mellitus: the cardiovascular and metabolic diseases etiology research center cohort. Diabetes Metab 2020; 44(5): 687-98.
[2] Kantharidis P, Bo Wang, Rosemarie M. Carew, Hui Yao Lan. Diabetes Complications: The MicroRNA Perspective. Diabetes 2011; 60: 1832-7.
[3] Yamagishi S. Role of advanced glycation end products (AGEs) and receptor for AGEs (RAGE) in vascular damage in diabetes. Exp Gerontol 2015; 46(4): 217–24.
[4] Porter KE, Riches K. The vascular smooth muscle cell: a therapeutic target in Type 2 diabetes?. Clin Sci Lond 2013; 125(4): 167-82.
[5] Hsu WT, Tsai LY, Lin SK, Hsiao JK, Chen BH. Effects of diabetes duration and glycemic control on free radicals in children with type 1 diabetes mellitus. Ann Clin Lab Sci 2006; 36(2): 174-8.
[6] Afkhamy ardakani M. The effect of Aerobic training on Klotho-FGF23 axis and arterial calcification in type 2 diabetic Postmenopausal women. J Sport Exerc Psychol 2020; 13(1): 27-38. [Farsi]
[7] Bektas A, Schurman SH, Sharov AA, Carter MG, Dietz HC, Francomano CA. Klotho gene variation and expression in 20 inbred mouse strains. Mamm Genome 2004; 15(10): 759-67.
[8] Soleimany A, Hajizadeh R, Khadem vatani K, Seyyed-Mohammadzad M H, Khan ahmadi S. Evaluation of serum klotho level in paitients with and without coronary disease. Stud Med Sci 2020; 31(3): 178-87. [Farsi]
[9] Lim K, Lu T S, Molostvov G, Lee C, Lam FT, Zehnder D, et al. Vascular Klotho deficiency potentiates the development of human artery calcification and mediates resistance to fibroblast growth factor 23. Circulation 2012; 125(18): 2243-55.
[10] Kuro-oM. The FGF23and Klotho system beyond mineral metabolism. Clin Exp Nephrol 2017; 21(1): 64-9.
[11] Kurosu H, Ogawa Y, Miyoshi M, Yamamoto M, Nandi A, Rosenblatt KP, et al. Regulation of Fibroblast Growth Factor-23 Signaling by Klotho. J Biol Chem 2006; 281(10): 6120-3.
[12] Seiler S, Cremers B, Rebling N M, Hornof F, Jeken J, Kersting S, et al. The phosphatonin fibroblast growth factor 23 links calcium–phosphate metabolism with left-ventricular dysfunction and atrial fibrillation. Eur Heart J 2011; 32(21): 2688-96.
[13] Fukumoto S. Physiological regulation and disorders of phosphate metabolism-pivotal role of fibroblast growth factor 23. Inter med 2008; 47(5): 337-43.
[14] Saghiv M, Sherve C, Ben-Sira D, SagivM, Goldhammer E. Aerobic training effect on blood S-Klotho levelsin coronary artery disease patients. J Clin Exp Cardiol 2016; 7(8): 1-4.
[15] Ratanapo S, Kittanamongkolchai W, Srivali N, Ahmed S, Cheungpasitporn W, Chongnarungsin D. The Role of Fibroblast Growth Factor-23 in Left Atrial Volume. Am Heart J 2013; 165(5): 902-9.
[16] Geach T. FGF-23 associated with incident AF—a link with CKD?. Nat Rev Cardiol 2014; 11(8): 436-6.
[17] Kurosu H, Ogawa Y, Miyoshi M, Yamamoto M, Nandi A, Rosenblatt K P, et al. Regulation of fibroblast growth factor-23 signaling by klotho.  J Biol Chem 2006; 281(10): 6120-3.
[18] Bolboli L, Khajehlandi M. A Comparison of the Effect of Endurance Training on the Activities of Glutathione Peroxidase and Superoxide Dismutase in the Cardiac Tissue of Healthy and Diabetic Rats. Yafte 2020; 21 (4): 20-31. [Farsi]
[19] Najafipour H, Rostamzadeh F, Yeganeh-Hajahmadi M, & Joukar S. Improvement of Cardiac Function in Rats With Myocardial Infarction by Low-Intensity to Moderate-Intensity Endurance Exercise Is Associated With Normalization of Klotho and SIRT1. J Cardiovasc Pharmacol 2021; 77(1): 79-86.
[20] Avin K G, Coen P M, Huang W, Stolz D B, Sowa GA, Dubé J J, et al. Skeletal muscle as a regulator of the longevity protein, Klotho. Front Physiol 2014; 17: 5: 189-98.
[21] Li DJ, Fu H, Zhao T, Ni M, Shen FM. Exercise-stimulated FGF23 promotes exercise performance via controlling the excess reactive oxygen species production and enhancing mitochondrial function in skeletal muscle. Metabolism 2016; 65(5): 747-56.
[22] Ascensão A, Ferreira R, Magalhães J. Exercise-induced cardioprotection - biochemical, morphological and functional evidence in whole tissue and isolated mitochondria. Int J Cardiol 2007; 117(1): 16–30.
[23] Szkudelski T, The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol Res 2001; 50(6): 537-46.
[24] Chae CH, Jung SL, An SH, Jung CK, Nam SN, Kim HT. Treadmill exercise suppresses muscle cell apoptosis by increasing nerve growth factor levels and stimulating p-phosphatidylinositol 3-kinase activation in the soleus of diabetic rats & quot.  Physiol Biochem 2011; 67(2): 235-41.
[25] Fatemi S, fallahmohammadi Z. The effect of vitamin D supplementation on the levels of Klotho in the brain tissue of female lewis rats after 6 weeks of swimming. J Sports Sci 2018; 10(2): 207-19.
[26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the2-DDCT method. Methods 2001; 25(4): 402–8.
[27] Takeshita K, Fujimori T, Kurotaki Y, Honjo H, Tsujikawa H, Yasui K, et al.  Sinoatrial node dysfunction and early unexpected death of mice with a defect of klotho gene expression. Circulation 2004; 109(14): 1776-82.
[28] Rokhsati S, Souri R, Shabkhiz F, Rabbani SH, Shahsavari Z. Effect of High Intensity Interval Training on the Level of Atrial Fibrillation, Fibroblast Growth Factor 23 and Klotho Protein in Male Rats with Renal Failure. J Shahid Sadoughi Uni Med Sci 2020; 28(5): 2660-72. [Farsi]
[29] Powers SK, Smuder AJ, Kavazis AN, Quindry JC. Mechanisms of Exercise-Induced Cardioprotection. Physiol 2014; 29(1): 27-38.
[30] Powers SK, Quindry JC, Kavazis AN. ExerciseInduced Cardioprotection Against Myocardial. Ischemia–Reperfusion Injury. Free Radical Biology Med 2008; 44(2): 193-201.
[31] Saito Y, Yamagishi T, Nakamura T, Ohyama Y, Aizawa H, Suga T, et al. Klotho Protein Protects Against Endothelial Dysfunction. Biochem Biophys Res Commun 1998; 248(2): 324-9.
[32] Doi S, Zou Y, Togao O, Pastor JV, John GB, Wang L, et al. Klotho Inhibits Transforming Growth Factor-Β1 (TGF-Β1) Signaling and Suppresses Renal Fibrosis and Cancer Metastasis in Mice. J Biolog Chem 2011; 286(10): 8655-65.
[33] Fleenor BS, Marshall KD, Durrant JR, Lesniewski LA, Seals DR. Arterial Stiffening With Ageing is Associated with Transforming Growth Factor Β1 Related Changes in Adventitial Collagen: Reversal by Aerobic Exercise. J Physiol 2010; 588(20): 3971-82.
[34] Cadigan KM, Liu YI. Wnt Signaling: Complexity at the Surface. J Cell Sci 2006; 119(3): 395-402.
[35] Shirinzadeh M, Shakerhoseini R, Navaee L, Hoshyar rad A, Saadat N, Golestan B. Assessment of vitamin D supplementation effect on insulin resistance among type 2 diabetic patients. Iranian Journal of Nutrition Sciences & Food Technology 2008; 15; 1(2): 1-6. [Farsi]
[36] Ramez M, Rajabi H, Ramezani F, Naderi N, Darbandi-Azar A, Nasirinezhad F. The Greater Effect of High-Intensity Interval Training Versus Moderate-Intensity Continuous Training on Cardioprotection Against Ischemia-Reperfusion Injury Through Klotho Levels and Attenuate of Myocardial TRPC6 Expression. BMC Cardiovasc Disord 2019; 19(1): 118-27.
[37] Fakhrzadeh H, Sharifi F. Pre-clinical atherosclerosis, a review article. IJDO 2017; 15; 10(2): 117-29.
[38] Kizilgul M, Kan S, Beysel S, Apaydin M, Ozcelik O, Caliskan M, et al. I fibroblast growth factor 23 a new cardiovascular risk marker in gestational diabetes?. Arch Endocrinol Metab 2017; 61(6): 562-66.
[39] Kitagawa M, Sugiyama H, Morinaga H, Inoue T, Takiue K, Ogawa A, et al. A decreased level of serum soluble Klotho is an independent biomarker associated with arterial stiffness in patients with chronic kidney disease. PloS one 2013; 8(2): e56695.


 
The Effect of Six Weeks of Moderate-Intensity Endurance Training on Serum Levels of Klotho and Expression of the Fibroblast-23 Growth Factor Gene (FGF23) in the Hearts of Diabetic Rats: An Experimental Study
 
                                                                                                                                                                                                                                                                                                                                                         
 
L. Bolboli[3], M. Khajehlandi[4]
 
Received: 28/03/21      Sent for Revision: 24/04/21     Received Revised Manuscript: 15/05/21     Accepted: 16/05/21
 
 
Background and Objectives: Diabetic patients are highly susceptible to cardiovascular involvement. Therefore, the aim of the present study was to determine the effect of six weeks of moderate-intensity endurance training on serum levels of Klotho and expression of the fibroblast-23 growth factor (FGF23) gene in the hearts of diabetic rats.
Materials and Methods: In this experimental study, 21 adult male Wistar rats were randomly divided into three groups of seven: diabetic training group (DT), diabetic control group (DC), and healthy control group (HC). Diabetes was induced by intraperitoneal injection of Streptozotocin (STZ). Animals performed moderate-intensity endurance training for six weeks. Serum levels of Klotho and FGF23 gene expression in the heart tissue were evaluated by Elisa method and real time PCR, respectively. Data were analyzed by one-way analysis of variance and Scheffe’s post hoc test.
Results: The findings showed that after six weeks of training, blood glucose concentration (mg/dl) in the DT group was significantly lower than the DC group (p=0.001), and serum levels of Klotho (ng/ml) was significantly increased compared to the DC (p=0.032), but there was no significant difference between the DT and DC groups in the expression of FGF23 gene (relative expression) (p=0.171).
Conclusion: The results suggested that moderate-intensity endurance training has a positive effect on the serum levels of Klotho and blood glucose, and it appears to be somewhat protective of heart function.
Key words: Klotho, FGF23, Endurance training, Diabetes, Heart, Rat
 
Funding: This study was funded by University of Mohaghegh Ardabili.
Conflict of interest: None declared.
Ethical approval: The Ethics Committee of Ardabil University of Medical Sciences approved the study (IR.ARUMS.REC.1398.251).
 
How to cite this article: Bolboli L, Khajehlandi M. The Effect of Six Weeks of Moderate-Intensity Endurance Training on Serum Levels of Klotho and Expression of the Fibroblast-23 Growth Factor Gene (FGF23) in the Hearts of Diabetic Rats: An Experimental Study. J Rafsanjan Univ Med Sci 2021; 20 (4): 371-86. [Farsi]


 
[1]- (نویسنده مسئول) دانشیار، گروه فیزیولوژی ورزشی، دانشکده علوم تربیتی و روانشناسی، دانشگاه محقق اردبیلی، اردبیل، ایران
تلفن: 33520457-045، دورنگار: 33520457-045، پست الکترونیکی:  l_bolboli@uma.ac.ir
[2]- دانشجوی دکترا، گروه فیزیولوژی ورزشی، دانشکده علوم تربیتی و روانشناسی، دانشگاه محقق اردبیلی، اردبیل، ایران
 
  1. - Associate Prof., Dept. of Exercise Physiology, Faculty of Educational Sciences and Psychology, University of Mohaghegh Ardabili, Ardabil, Iran, ORCID: 0000-0002-7981-4343
(Corresponding Author) Tel: (045) 33520457, Fax: (045) 33520457, E-mail: l_bolboli@uma.ac.ir
  1. - PhD Candidate, Dept. of Exercise Physiology, Faculty of Educational Sciences and Psychology, University of Mohaghegh Ardabili, Ardabil, Iran, ORCID: 0000-0002-5275-9305
نوع مطالعه: پژوهشي | موضوع مقاله: تربيت بدني
دریافت: 1400/1/7 | پذیرش: 1400/2/26 | انتشار: 1400/4/28

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2021 CC BY-NC 4.0 | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb