جلد 18، شماره 5 - ( 4-1398 )                   جلد 18 شماره 5 صفحات 417-426 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Rezaei R, Fathi M. The Effect of Intensive Endurance Activity on Myocyte Enhancer Factor 2C Gene Expression of Slow and Fast Twitch Muscles in Male Wistar Rats: An Experimental Study . JRUMS. 2019; 18 (5) :417-426
URL: http://journal.rums.ac.ir/article-1-4390-fa.html
رضایی راضیه، فتحی محمد. تأثیر فعالیت استقامتی شدید بر بیان ژن فاکتور 2 افزایش دهنده میوسیت‌های نوع C در عضلات کند و تند انقباض موش صحرایی نر: یک مطالعه تجربی. مجله دانشگاه علوم پزشکی رفسنجان. 1398; 18 (5) :417-426

URL: http://journal.rums.ac.ir/article-1-4390-fa.html


دانشگاه لرستان
متن کامل [PDF 317 kb]   (190 دریافت)     |   چکیده (HTML)  (438 مشاهده)
متن کامل:   (101 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 18، مرداد 1398، 426-417
 
 
 
 
 
 
 
 
 
تأثیر فعالیت استقامتی شدید بر بیان ژن فاکتور 2 افزایش دهنده میوسیت‌های نوع C در عضلات کند و تند انقباض موش صحرایی نر: یک مطالعه تجربی
 
راضیه رضایی[1]، محمد فتحی[2]
 
دریافت مقاله: 26/6/97   ارسال مقاله به نویسنده جهت اصلاح: 22/7/97    دریافت اصلاحیه از نویسنده: 21/12/97       پذیرش مقاله: 22/12/97
 
 
 
 

چکیده
زمینه و هدف: فاکتور 2 افزایش دهنده میوسیت‌های نوع c (MEF2c) موجب فعال­سازی ژن­های عضله کند انقباض می‌شود که در فعالیت استقامتی نقش دارند. هدف این مطالعه، تعیین اثر یک دوره فعالیت استقامتی شدید بر بیان ژن MEF2c  در عضله اسکلتی تند و کند انقباض موش صحرایی نر نژاد ویستار است.
مواد و روش‌ها: در مطالعه تجربی حاضر 14 موش صحرایی (24±231 گرم) بعد از آشناسازی به صورت تصادفی به دو گروه کنترل (7 سر) و تجربی (7 سر) تقسیم شدند. گروه تجربی یک برنامه استقامتی (30 متر در دقیقه، 50 دقیقه در جلسه، 6 جلسه در هفته به مدت 14 هفته) را روی تردمیل اجرا کرد. 48 ساعت پس از پایان آخرین جلسه بی‌هوش و تشریح شدند. عضله نعلی (کند انقباض) و عضله بازکننده بلند انگشتان (تند انقباض) خارج و با استفاده از روش واکنش زنجیره پلی‌مراز میزان بیان ژن MEF2c اندازه‌گیری شد. داده‌ها با استفاده از آزمون آماری t مستقل داده­ها تحلیل شدند.
یافته­ها: بیان ژن MEF2c در عضله تند انقباض گروه تجربی در مقایسه با گروه کنترل به طور معنی­داری بیش‌تر بود (001/0=p) و بیان ژن MEF2c در عضله نعلی گروه تجربی نسبت به گروه کنترل پس از 14 هفته فعالیت استقامتی به طور معنی­داری افزایش یافت (022/0=p).
نتیجه­گیری: فعالیت استقامتی شدید موجب افزایش بیان ژن MEF2c در عضلات اسکلتی تند و کند انقباض می­شود و این تغییر بیان ژن، احتمالاً زمینه کسب خصوصیات استقامتی در هر دو عضله را فراهم می­کند.
واژه­های کلیدی: فعالیت استقامتی، ژن MEF2C، عضله نعلی، موش صحرایی، عضله بازکننده بلند انگشتان
 
مقدمه
فعالیت بدنی بر بافت عضلانی، پروتئین و ژن­های آن‌ها تأثیرگذار است، از جمله این پروتئین و ژن­ها می‌توان به فاکتور افزایش دهنده میوسیت نوع 2 c (Myocyte Enhancer Factor-2c; MEF2c) اشاره کرد ]1[. پروتئین MEF2c به عنوان یک عامل کلیدی در رشد، بیان ژن، کنترل نوع عضله درگیر است ]2[. ژن این پروتئین یعنی MEF2c (فاکتور-2 افزایش دهنده میوسیت) با چندین فاکتور تنظیمی میوژنیک در ارتباط است و موجب فعال‌سازی ژن­های ویژه عضله می­شود ]4-3[. برخی از ژن­ها که توسط این فاکتور تنظیم می‌شوند عبارتند از مایوژنین، پروتئین تمایزی عضله (myoD)، میوگلوبین و تروپونین C ]5[. بیان ایزومرهای MEF2c برای رشد و توسعه عضلات اسکلتی ضروری‌اند ]6[ و در تمایز میوبلاست­ها به میوتیوب‌ها نقش دارند، بسیاری از ژن­های بیان­شده در عضله به خصوص ژن­های مرتبط با عضلات اسکلتی نوع کند توسط MEF2c تنظیم می­شوند ]7[.
فعالیت‌ استقامتی بر فاکتورهای رونویسی تأثیر دارد، در تأیید این موضوع نتایج برخی پژوهش‌ها نشان داده که فسفوریلاسیون بخش تیرونین MEF2 در اثر یک جلسه تمرین 90 دقیقه‌ای افزایش می‌یابد که موجب افزایش mRNA فاکتورهای MEF2a، MEF2c و MEF2d نیز می‌شود [8]. در پژوهشی در بین مردان جوان مشخص شد که تمرین حاد استقامتی موجب افزایش فعالیت اتصال MEF2 به DNA می‌شود [9].
فاکتور رونویسی MEF2c عمدتاً با فعال­سازی بیان تارهای اکسیداتیو در ارتباط است، از جمله محرک­هایی که بر فرآیندهای سلولی در عضلات تأثیرگذار است، فعالیت­بدنی است ]11-8[، که از طریق مسیرهای سیگنالینگ تغییراتی در ساختار و عملکرد عضله ایجاد می­کند ]12[. تحقیقاتی در این مورد صورت گرفته که نتایج برخی از آن‌ها گزارش می‌شود. مشخص شده که فعالیت­بدنی باعث افزایش بیان MEF2c می­شود ]13[ و تغییر در عملکرد آن می­شود ]15-14[ MEF2c در تمایز ]7[ و تبدیل نوع تارها نیز نقش دارد ]16[.
فعالیت استقامتی بر فعال­سازی فرآیند تکثیر و تمایز سلول­های ماهواره­ای ]17[ و تبدیل نوع تارها ]19-18 ،16[ اثر دارد از طرف دیگر ژن MEF2c در تمایز سلول­های عضلانی به سمت تارهای کند انقباض نقش دارد ]3[. با توجه به تفاوت عضلات کند انقباض و تند انقباض در پاسخ به محرک یک‌سان (از نظر نوع فعالیت، حجم فعالیت و مدت فعالیت ورزشی) و هم‌چنین گستردگی فرآیندهایی که ژن MEF2c در آن‌ها دخیل است سؤال اصلی این پژوهش این است که آیا فعالیت‌های طولانی‌مدت استقامتی (محرک یک‌سان) تأثیر یک‌سانی بر بیان این ژن در عضلات تند و کند انقباض دارند؟ از آن‌جایی که روشن شدن تغییرات پایه‌ایی فیزیولوژیکی و ژنتیکی درک ما را از تأثیر فعالیت‌های ورزشی بر عضلات اسکلتی چه با رویکرد درمانی و چه با رویکرد قهرمانی افزایش می‌دهد، انجام پژوهشی در این مورد ضروری به نظر می‌رسد. بنابراین، هدف این پژوهش تعیین تأثیر یک دوره فعالیت استقامتی شدید بر بیان ژن MEF2c عضلات تند و کند انقباض موش‌های صحرایی نر نژاد ویستار است.
مواد و روش­ها
پژوهش حاضر از نوع تجربی بود که بر روی موش‌های صحرایی سالم انجام شد. این پژوهش بر مبنای اصول اخلاقی انجام شده است پژوهش در سال 1396 با کد 13961021677 توسط کمیته اخلاق دانشگاه لرستان تأیید شده است. در این پژوهش اثر یک برنامه فعالیت استقامتی (14 هفته) بر بیان ژن MEF2c عضلات تند و کند انقباض ارزیابی شد. در ابتدا 20 سر موش صحرایی نر نژاد ویستار با 5 هفته سن و وزن 20 ± 113گرم از انستیتو پاستور تهیه شد. همه آن‌ها در شرایط مناسب (دسترسی آزاد به آب و غذای مخصوص موش صحرایی، چرخه روشنایی و تاریکی 12:12 ساعت، میانگین دما 3 ± 22 درجه سانتی گراد و رطوبت 5±55) به صورت یک‌سان در آزمایشگاه حیوانات تا رسیدن به سن بلوغ (8 هفته) در 4 قفس یک‌سان نگه‌داری شدند. در پایان این مرحله، میانگین و انحراف استاندارد وزن موش‌های صحرایی 24±231 گرم بود. سپس دوره آشناسازی با تمرینات استقامتی آغاز شد که 10 روز (5 جلسه) برای آشنایی با دویدن روی تردمیل (9 متر در دقیقه، 5 دقیقه و 4 روز در هفته) زمان صرف شد ، سپس به صورت تصادفی به 2 گروه (10 سر به عنوان گروه کنترل و 10 سر دیگر به عنوان گروه تجربی) تقسیم شدند. از گروه تجربی 3 سر نتوانست برنامه تمرینی را به پایان برساند، بنابراین با توجه به روش اندازه­گیری نسبی (Real time relative quantification) در تکنیک واکنش زنجیره پلیمراز (Real-Time polymerase chain reaction) سه سر از گروه کنترل به صورت تصادفی کنار نهاده شد و تعداد نهایی به 14 سر (7 سر کنترل و 7 سر تجربی) کاهش یافت.
با استفاده از منابع پیشین یک برنامه تمرین استقامتی برای آنان طراحی شد ]21-20[. برنامه تمرینی (14 هفته، هفته­ای 6 روز) گروه تجربی عبارت بود از دویدن روی تردمیل که سرعت و شیب و زمان آن قابل برنامه‌ریزی بود. پروتکل این پژوهش با یک دوره گرم‌کردن آغاز می‌شد. دوره گرم ‌کردن این پروتکل عبارت بود از 5 دقیقه دویدن روی تردمیل با سرعت 12 متر در دقیقه با شیب صفر درجه، بعد از گرم ‌کردن بدنه اصلی پروتکل اجرا می‌شد که زمان آن 50 دقیقه بود، اما سرعت آن طی دوره تمرینی یعنی 14 هفته از 20 متر در دقیقه (طی 5 هفته اول) به 30 متر در دقیقه رسید و از هفته هفتم تا پایان هفته دهم شیب تردمیل به 5 درجه افزایش یافت و در نهایت تا پایان هفته چهاردهم پروتکل بدون تغییر اجرا شد. در پایان هر جلسه تمرینی بخش سرد کردن اجرا می‌شد که سرعت اجرای آن 9 متر در دقیقه به مدت 5 دقیقه بود. قابل ذکر است بخش اصلی این برنامه با حدود 70 درصد حداکثر حجم اکسیژن مصرفی (Vo2 max) موش صحرایی اجرا شد ]23- 22[ این برنامه بین ساعات 5 تا 7 بعد از ظهر هر روز اعمال می­شد. طی این مدت گروه کنترل در داخل جعبه‌ها بودند و درگیر فعالیت بدنی نبودند.
بعد از پایان برنامه استقامتی و 48 ساعت پس از آخرین جلسه تمرینی موش‌های صحرایی با ترکیبی از کتامین (50 میلی­گرم به ازای هر کیلوگرم) و زایلازین (5 میلی­گرم به ازای هر کیلوگرم) بی‌هوش شدند. بعد از بیهوشی کامل (به طوری که به تحریک اعمالشده پاسخ ندهد)، عضله نعلی (عضله کند انقباض) و عضله باز کننده بلند انگشتان (Extensor digitorum longus; EDL) تحت شرایط استریل خارج شد. بافت­های مورد نظر بلافاصله وارد تانک نیتروژن شدند. بعد از اتمام تشریح و تا شروع هموژن بافتها، همه آن‌ها در دمای 80- درجه سانتی‌گراد نگه‌داری شدند [1].
برای استخراج ریبوز نوکلئیک اسید (RNA) از بافتهای هموژن شده، به 100 میلی‌گرم از بافت داخل میکروتیوب، 1 میلی‌لیتر ترایزول اینویتروژن (Invitrogen) اضافه شد و پس از مخلوطکردن کامل (پیپتاژ کردن) به مدت 5 دقیقه در دمای اتاق نگه‌داری (انکوبه) شد، سپس 2/0 میلی‌لیتر به آن کلروفرم سرد اضافه شد و پس از پیپتاژ (15 ثانیه) حدود 2 تا 3 دقیقه در دمای اتاق انکوبه شد، در ادامه میکروتیوبها به مدت 15 دقیقه در دمای 4 درجه سانتی‌گراد با 12000 دور سانتریفیوژ (شرکت Eppendorff، مدل 5810 آلمان) شدند، سپس مایع رویی به دقت برداشته شد و به یک میکروتیوب RNAase free انتقال داده شد (از این مرحله به بعد با سرسمپلر فیلتردار کار شد). سپس 5/0 میلی‌لیتر ایزوپروپانول سرد اضافه شد و بعد از هم­زدن ملایم در دمای 20- درجه سانتی‌گراد باقی ماندند (Overnight). روز بعد میکروتیوبها به مدت 15 دقیقه در دمای 4 درجه سانتی‌گراد با 12000 دور در دقیقه مجدداً سانتریفیوژ شدند که در این مرحله یک رسوب سفید رنگ در ته اکثر میکروتیوب‌ها قابل مشاهده بود. با سمپلر (شرکت Eppendorff، آلمان) مایع رویی با دقت خارج شد و 1 میلی‌لیتر اتانول خالص سرد به آن اضافه شد و بعد از تکان­دادن مختصر به مدت 5 دقیقه در دمای 4 درجه سانتی‌گراد با 7500 دور در دقیقه سانتریفیوژ شدند و در ادامه مایع رویی به دقت تخلیه شد و 10 دقیقه فرصت داده شد تا باقیمانده اتانول تبخیر شود و داخل میکروتیوب خشک شود. بعد از این مرحله 50 لاندا آب تزریقی به هر نمونه اضافه شد و چند بار به آرامی پیپتاژ صورت گرفت. در پایان غلظت و نسبت جذبی نمونه­ها با استفاده ازمدل دستگاه اسپکتروفتومتر مدل Basic (شرکت Eppendorff ، آلمان) ارزیابی شد که نسبت جذبی 280/260 نانومتر برای تمام نمونهها بین 6/1 تا 8/1 بود. تمام مراحل کار زیر هودی که از قبل آماده شده بود (استریل شده با الکل 75 درصد و نور ماورا بنفش) انجام می‌شد، غیر از مراحلی که نیاز بود میکروتیوبهای حاوی مواد، سانتریفیوژ و یا ورتکس شوند [6].
برای رونویسی RNA به دزوکسی ریبوز نوکلئیک اسید مکمل (cDNA) از کیت شرکت ترموساینتفیک Scientific) Thermo با کت نامبر (Cat # K1621 استفاده شد. تمام مراحل مطابق دستورالعمل شرکت سازنده با استفاده از رندوم هگزامر (Random hexamer) انجام شد [1]. ترموسایکلر مورد استفاده در این مرحله متعلق به شرکت Eppendorff آلمان بود. قبل از ارزیابی نهایی بیان ژن طبق دستورالعمل تکنیک PCR Real time نیاز بود که میزان کارآیی (Efficiency) ژن رفرنس گلیسرآلدئید 3 فسفات دی هیدروژناز (Glyceraldehyde 3-Phosphate Dehydrogenase; gapdh) و ژن هدف (MEF2c) برای هر عضله بررسی شود که مشخص شد میزان کارآیی برای این دو ژن در بالاترین میزان خود (یعنی 1) بود. در ادامه ارزیابی بیان ژن از تکنیک Real time PCR و دستگاه شرکت آپلاید بایوسیستم (Applied Biosystem) کشور آمریکا استفاده شد. سایبرگرین مسترمیکس (SYBR green master mix) استفاده شده در این مرحله متعلق به شرکت تاکارا ژاپن با کت نامبر Cat # RR820L بود. طبق دستورالعمل کیت و بررسی میزان کارآیی ژن رفرنس و هدف، برای یک نمونه 10 لاندایی ترکیبی از مسترمیکس (5 لاندا) پرایمر (1 لاندا)، cDNA (1 لاندا) و آب مقطر (3 لاندا) در نظر گرفته شد و میزان بیان ژن با استفاده از روش نسبی ارزیابی شد. در هر دور (Run)40 سیکلی یک نمونه به عنوان کنترل منفی برای تعیین آلودگی مسترمیکس که طبق دستورالعمل شرکت آپلاید بایوسیستم نباید سیکل آستانه (cycle threshold; CT) آن کم‌تر از 35 باشد، در نظر گرفته شد. کنترل داخلی (GAPDH)، کنترل مثبت (گروه کنترل) و MEF2c همزمان در یک Run به صورت دوتایی (Duplicate) ارزیابی شدند. بعد از به دست آوردن CT دوتایی برای هر نمونه میانگین آن‌ها محاسبه شد. لازم به ذکر است در برخی موارد نیاز بود تست مجدداً تکرار شود که در صورت نیاز تکرار میشد. بعد از انتقال اطلاعات به نرم افزار اکسل Excel نسخه 2010 طبق فرمول 2-ΔΔCt میزان بیان ژن MEF2c محاسبه شد [24]. مشخصات پرایمرها در جدول 1 مشخص شده است.
 
 
جدول 1- مشخصات پرایمرهای مورد استفاده در این پژوهش
 
 
اندازه محصول NCBI توالی رفرنس توالی 5-3   اسم ژن
74 NM_017008.4 AACCCATCACCATCTTCCAG F GAPDH
CACGACATACTCAGCACCAG R
84 XM_017591165.1 CCATTGGACTCACCAGACCT F MEF2c
ATGTTGCCCATCCTTCAGAG R
 
 
 
داده­های به دست آمده از دستگاه Real time PCR که به صورت CT بودند. با استفاده از نرم افزار اکسل Excel نسخه 2010 به ΔΔct تبدیل شدند و سپس با استفاده از فرمول 2-ΔΔC اعداد نهایی به دست آمد. با انتقال این اعداد به نرم­افزار SPSS نسخه 20 ابتدا نرمال­بودن توزیع دادهها با استفاده از آزمون Shapiro-Wilks ارزیابی شد و مشخص شد که دادهها دارای توزیع طبیعی هستند (05/0 p>) سپس برای تعیین اختلاف میانگین گروه تجربی از گروه کنترل از آزمون t مستقل استفاده شد، از نظر آماری مقدار 05/0p< معنی‌دار در نظر گرفته شد.
نتایج
با توجه به نتایج جدول 2، در پایان مطالعه مشخص شد که بین وزن موش­های صحرایی گروه تجربی و گروه کنترل تفاوت وجود دارد اما این تفاوت معنی‌دار نبود (056/0=p). مقادیر آزمون t (33/6) نشان داد میزان بیان ژن MEF2c در عضله بازکننده بلند انگشتان پس از 14 هفته فعالیت استقامتی نسبت به گروه کنترل افزایش یافت که این افزایش با 001/0=p معنی­دار بود به این معنی که میزان بیان ژن MEF2c در گروه تجربی 8/2 برابر افزایش داشت (نمودار 1). هم‌چنین مقادیر آزمون t (058/3) نشان داد که بیان ژن MEF2c در عضله نعلی گروه تجربی پس از 14 هفته فعالیت استقامتی 2 برابر افزایش یافت که این افزایش در مقایسه با گروه کنترل با 022/0=p معنی‌دار بود (نمودار 2).
 
جدول 2- میانگین وزن موش­های صحرایی در ابتدا و انتهای دوره­ی تمرینی این پژوهش (14n=)
 
  گروه کنترل (تعداد=7) گروه تجربی (تعداد=7) مقدار  p
وزن (گرم) موش‌های صحرایی قبل از آغاز دوره تمرینی 06/8 ± 4/221 94/4 ± 9/220 412/0
وزن (گرم) پایانی موش‌های صحرایی قبل از تشریح 56/ 15 ± 2/361 30 ± 2/331 056/0
مقدار p 001/0 001/0  
 
نتایج آزمون  t زوجی جهت تعیین تفاوت وزن موش‌های صحرایی گروه‌ها (کنترل و تجربی) قبل (412/0 p =) و بعد از دوره تمرینی (056/0 p =) و t  مستقل برای تعیین اختلاف وزن گروه کنترل (001/0 p =) و گروه تجربی (001/0 p =) در ابتدا و انتهای دوره تمرینی پژوهش حاضر
 
 

نمودار 1- تأثیر یک دوره فعالیت استقامتی بر بیان ژن MEF2c عضله بازکننده بلند انگشتان موش‌های صحرایی نر در گروه کنترل و تجربی  (14n=)
نتایج آزمون t  مستقل،  * نشان دهنده وجود تفاوت معنی‌دار بین گروه‌های تجربی و کنترل (001/0=(p
 

نمودار 2- تأثیر یک دوره فعالیت استقامتی بر بیان ژن MEF2c  عضله نعلی موش‌های صحرایی نر در گروه کنترل و تجربی(14n=)
نتایج آزمون t مستقل، * نشان دهنده وجود تفاوت معنی‌دار بین گروه کنترل و تجربی (022/0=p)
بحث
نتایج تحقیق حاضر نشان داد که بیان ژن MEF2c در عضله بازکننده بلند انگشتان و نعلی پس از 14 هفته فعالیت استقامتی نسبت به گروه کنترل افزایش می­یابد. تعداد پژوهش­ها در مورد این فاکتور با رویکرد فعالیت­بدنی به خصوص فعالیت­های استقامتی بلندمدت بسیار کم است، اما به طور کلی مشخص شده است که سرکوب بیان این ژن در عضله نعلی موجب افزایش بیان تارهای تند انقباض و کاهش معنی­دار تارهای کند انقباض در این عضله می­شود ]2[.
نتایج برخی پژوهش­ها که تأثیر فعالیت‌­بدنی بر بیان ژنMEF2c  عضلات اسکلتی را بررسی کرده­­ است، نشان داد که میزان بیان این ژن در پی فعالیت بدنی افزایش می­یابد ]25[ که با نتایج این پژوهش هم‌خوانی دارد. در پژوهشی مشخص شد میزان بیان این ژن در عضله پهن جانبی (زنان و مردان) بعد از یک جلسه فعالیت استقامتی (60 درصد Vo2peak) افزایش یافت ]26[. در حقیقت فاکتور رونویسیMEF2c  ادغام­کننده چندین مسیر سیگنالینگ مهم عضلات اسکلتی است که توسط کلسیم بیان ژن را تنظیم می­کنند. انقباض عضلات از طریق مسیرهایی (که لزوماً شامل پروتئین فسفاتاز کالسی‌نورین هستند) فعالیت رونویسی MEF2c را افزایش می‌­دهد ]16[. در موش‌ها دیده شده است که فاکتور MEF2c با فعال‌سازی ژن‌های درگیر در تمایز عضله، موجب توسعه عضلات اسکلتی می‌شود ]27[ و فعال­سازی مسیرهای کالسی­نورین و MEF2c موجب بهبود بیان ژن­های ویژه عضله مانند میوگلوبین، زنجیره سنگین میوزین و تروپونین1 نوع کند می­شود ]28، 5[. کالسی­نورین و MEF2c در مکانیزم سازگاری شرکت می­کنند که کسب خصوصیات انقباضی و متابولیکی ویژه توسط تارچه­ها، تابعی از الگوی انقباض القاءشده به وسیله فعالیت­بدنی است.
با توجه به عملکرد فاکتور رونویسی MEF2c که در بالا شرح داده شد (القاءکننده پروتئین­های درگیر در فعالیت­های استقامتی، تارهای کند انقباض) و نتایج پژوهش حاضر که نشان داد فعالیت استقامتی بلندمدت موجب افزایش بیان این ژن در تارهای کند و تند انقباض می­شود، به نظر می‌رسد که عضلات اسکلتی کند و تند انقباض با افزایش تارهای کند انقباض و هم‌چنین سایر پروتئین­های درگیر در فعالیت استقامتی، زمینه را برای افزایش مقاومت در مقابل خستگی فراهم می­آورند که در حقیقت یکی از سازگاری‌هایی است که در اثر فعالیت استقامتی رخ می­دهد. هم‌چنین با توجه به تأثیر فاکتور رونویسی MEF2c بر تغییر نوع تارهای عضله به سمت تارهای کند انقباض به نظر می‌رسد، برای ایجاد پاسخی مناسب و سازگاری در عضلات اسکلتی و هماهنگ شدن با نوع محرک (نوع فعالیت بدنی) بیان این ژن در عضله نعلی و بازکننده بلند انگشتان افزایش می‌یابد. Anderson  و همکاران نشان دادند که سرکوب بیان ژن MEF2c موجب کاهش بیان تارهای کند انقباض در عضله اسکلتی نعلی می­شود ]2[. اما مکانیزمی که ممکن است موجب افزایش بیان این ژن در عضلات اسکلتی شود احتمالاً به این صورت است که فعالیت استقامتی چالش­های متابولیکی شدیدی را در عضله ایجاد می­کند و موجب فعال‌سازی مسیر پروتئین کیناز فعال شده به وسیله آدنوزین منو فسفات (AMP-activated protein kinase; AMPK) ]29[ و هم‌چنین افزایش جریان کلسیم درون سلولی می‌شوند که در پایین دست این مسیرها موجب افزایش بیان ژن MEF2c می­شود و از این طریق میزان بیان این ژن افزایش می‌یابد ]5[.
از محدودیت‌های این تحقیق می‌توان به عدم اندازه‌گیری میزان پروتئین فاکتور رونویسی اشاره کرد، بنابراین نمی­توان یافته­ها موجود را به شکل­گیری پروتئین این ژن و تأثیرات نهایی این فاکتور رونویسی نسبت داد، به منظور نتیجه‌گیری بهتر در مورد تأثیر فعالیت استقامتی بر بیان این فاکتور رونویسی، پیشنهاد می‌شود که در پژوهشی مشابه علاوه بر اندازه‌گیری بیان ژن، میزان پروتئین MEF2c نیز اندازه‌گیری شود.  
نتیجه‌گیری
نتایج پژوهش حاضر نشان داد که فعالیت استقامتی بلندمدت موجب افزایش بیان ژن MEF2c در عضلات اسکلتی تند و کند انقباض می­شود که تغییر در بیان این ژن احتمالاً زمینه را برای کسب خصوصیات استقامتی بیش‌تر عضلات اسکلتی (تند و کند انقباض) فراهم می­کند و احتمالاً از این طریق میزان مقاومت آن‌ها را در برابر خستگی فراهم می­آورد، هرچند پژوهش‌های بیش‌تری برای تأیید این موضوع است.
تشکر و قدردانی
به این وسیله از معاونت محترم پژوهشی دانشگاه لرستان به دلیل تامین بخشی از منابع مالی این پژوهش تشکر می‌شود.
 
 
 
 
 
References
 
 
 
1] Fathi M. The Effect of Endurance Activity on Pgc-1 Alpha Gene Expression in Soleus and Extensor Digitorum Longus Muscles of Adult Male Wistar Rats. ZUMS Journal 2016; 24(106): 51-62. [Farsi]
[2] Anderson CM, Hu J, Barnes RM, Heidt AB, Cornelissen I, Black BL. Myocyte enhancer factor 2C function in skeletal muscle is required for normal growth and glucose metabolism in mice. Skelet Muscle 2015; 5(1): 1-7.
[3] Potthoff MJ, Wu H, Arnold MA, Shelton JM, Backs J, McAnally J, et al. Histone deacetylase degradation and MEF2 activation promote the formation of slow-twitch myofibers. J Clin Invest 2007; 117(9): 2459-67.
[4] Black BL, Olson EN. Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu Rev Cell Dev Biol 1998; 14(1): 167-96.
[5] Friday BB, Mitchell PO, Kegley KM, Pavlath GK. Calcineurin initiates skeletal muscle differentiation by activating MEF2 and MyoD. Differentiation 2003; 71(3): 217-27.
[6] Jama A, Huang D, Alshudukhi AA, Chrast R, Ren H. Lipin1 is required for skeletal muscle development by regulating MEF2c and MyoD expression. J Physiol 2019; 597(3): 889-901.
[7] Chen X, Gao B, Ponnusamy M, Lin Z, Liu J. MEF2 signaling and human diseases. Oncotarget 2017; 8(67): 112152-65.
[8] Vissing K, McGee SL, Roepstorff C, Schjerling P, Hargreaves M, Kiens B. Effect of sex differences on human MEF2 regulation during endurance exercise. Am J Physiol Endocrinol Metab 2008; 294(2): 408-15.
[9] McGee SL, Sparling D, Olson AL, Hargreaves M. Exercise increases MEF2- and GEF DNA-binding activity in human skeletal muscle. FASEB J 2006; 20(2): 348-9.
[10] Coffey VG, Zhong Z, Shield A, Canny BJ, Chibalin AV, Zierath JR, et al. Early signaling responses to divergent exercise stimuli in skeletal muscle from well-trained humans. FASEB J 2006; 20(1): 190-2.
[11] Dimitrov VG, Arabadzhiev TI, Dimitrova NA, Dimitrov GV. Eccentric Contraction-Induced Muscle Fibre Adaptation. Bio Automation 2009; 13 (4): 119-26.
[12] Bassel-Duby R, Olson EN. Signaling Pathways in Skeletal Muscle Remodeling. Annu Rev Biochem 2006; 75(1): 19-37.
[13] McGee SL, Sparling D, Olson AL, Hargreaves M. Exercise increases MEF2- and GEF DNA-binding activity in human skeletal muscle. FASEB J 2006; 20(2): 348-9.
[14] Liu Y, Heinichen M, Wirth K, Schmidtbleicher D, Steinacker JM. Response of growth and myogenic factors in human skeletal muscle to strength training. Br J Sports Med 2007; 42(12): 989-93.
[15] Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Myogenic gene expression at rest and after a bout of resistance exercise in young (18-30 yr) and old (80-89 yr) women. J Appl Physiol 2006; 101(1): 53-9.
[16] Wu H, Rothermel B, Kanatous S, Rosenberg P, Naya FJ, Shelton JM, et al. Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J 2001; 20(22): 6414-23.
[17] Kadi F. The effects of heavy resistance training and detraining on satellite cells in human skeletal muscles. The J Physiol 2004; 558(3): 1005-12.
[18] Wu H, Naya FJ, McKinsey TA, Mercer B, Shelton JM, Chin ER, et al. MEF2 responds to multiple calcium-regulated signals in the control of skeletal muscle fiber type. EMBO J 2000; 19(9): 1963-73.
[19] Adams GR, Hather BM, Baldwin KM, Dudley GA. Skeletal muscle myosin heavy chain composition and resistance training. J Appl Physiol 1993; 74(2): 911-5.
[20] Jin H, Yang R, Li W, Lu H, Ryan AM, Ogasawara AK, et al. Effects of exercise training on cardiac function, gene expression, and apoptosis in rats. Am J Physiol Heart Circ Physiol 2000; 279(6): 2994-3002.
[21] Sun L, Shen W, Liu Z, Guan S, Liu J, Ding S. Endurance exercise causes mitochondrial and oxidative stress in rat liver: effects of a combination of mitochondrial targeting nutrients. Life Sci J 2010; 86(1-2): 39-44.
[22] Wisloff U, Helgerud J, Kemi OJ, Ellingsen O. Intensity-controlled treadmill running in rats: VO2max and cardiac hypertrophy. Am J Physiol Heart Circ Physiol 2001; 280(3): 1301-10.
[23] Hoydal MA, Wisloff U, Kemi OJ, Ellingsen O. Running speed and maximal oxygen uptake in rats and mice: practical implications for exercise training. Eur J Cardiovasc Prev Rehabil 2007; 14(6): 753-60.
[24] Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001; 25(4): 402-8.
[25] Hitomi Y, Kizaki T, Katsumura T, Mizuno M, Itoh CE, Esaki K, et al. Effect of moderate acute exercise on expression of mRNA involved in the calcineurin signaling pathway in human skeletal muscle. IUBMB Life 2003; 55(7): 409-13.
[26] Vissing K, McGee SL, Roepstorff C, Schjerling P, Hargreaves M, Kiens B. Effect of sex differences on human MEF2 regulation during endurance exercise. Am J Physiol Endocrinol Metab 2008; 294(2): 408-15.
[27] Subramanian SV, Nadal-Ginard B. Early expression of the different isoforms of the myocyte enhancer factor-2 (MEF2) protein in myogenic as well as non-myogenic cell lineages during mouse embryogenesis. Mech Dev 1996; 57(1): 103-12.
[28] Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, et al. A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev 1998; 12(16): 2499-509.
[29] Atherton PJ, Babraj J, Smith K, Singh J, Rennie MJ, Wackerhage H. Selective activation of AMPK-PGC-1α or PKB-TSC2-mTOR signaling can explain specific adaptive responses to endurance or resistance training-like electrical muscle stimulation. The FASEB Journal 2005; 19(7): 786-8.
 

The Effect of Intensive Endurance Activity on Myocyte Enhancer Factor 2C Gene Expression of Slow and Fast Twitch Muscles in Male Wistar Rats: An Experimental Study
 
R. Rezaei [3], M. Fathi[4]
 
Received: 17/09/2018  Sent for Revision: 14/10/2018    Received Revised Manuscript: 12/03/2019              Accepted: 13/03/2019
 
Background and Objectives: Myocyte enhancer factor 2c activates the genes of the slow-twitch muscle, the muscle which plays role in endurance activity. Therefore, the aim of this study was to evaluate the effect of a program of intensive endurance activity on MEF2c gene expression in fast and slow twitch skeletal muscles in wistar rats.
Materials and Methods: In this experimental study, 14 males wistar rats (231 ± 24 grams), after familiarization were randomly assigned into control (n=7) and experimental (n=7) groups. The experimental group performed an endurance activity program (30 m/min, 50 min, 6 sessions per week for 14 weeks) on motorized treadmill, and 48 hours after the end of the last session of endurance activity were anesthetized and sacrificed then the soleus (slow-twitch) and extensor digitorum longus (fast-twitch) muscles were removed. Real time PCR was used to determine expression levels of MEF2c gene and the data were analyzed by independent t-test.
Results: The MEF2c gene expression in fast-twitch muscle of the experimental group was significantly more compared to the control group (p=0.001), and the expression of MEF2c gene in soleus muscle of the experimental group significantly increased after 14 weeks endurance activity compared to the control group (p=0.022).
Conclusion: Intensive endurance activity increases MEF2c gene expression in slow and fast twitch skeletal muscle which this change in gene expression probably provides grounds to obtain endurance characteristics in slow and fast twitch skeletal muscles.
Key word: Endurance activity, MEF2c gene, Soleus muscle, Rat, Extensor digitorum longus muscle
 
Funding: This research was partially funded by Lorestan University.
Conflict of interest: None declared.
Ethical approval: The Ethics Committee of Lorestan University approved the study (13961021677).
 
How to cite this article: Rezaei R, Fathi M. The Effect of Intensive Endurance Activity on Myocyte Enhancer Factor 2C Gene Expression of Slow and Fast Twitch Muscles in Male Wistar Rats: An Experimental Study. J Rafsanjan Univ Med Sci 2019; 18 (5): 417-26. [Farsi]
 
 
[1]- دانشجوی دوره دکترای فیزیولوژی ورزش، گروه تربیت‌بدنی و علوم ورزشی دانشکده تربیت بدنی، دانشگاه شهید چمران اهواز، اهواز، ایران
  1. - (نویسنده مسئول) استادیار فیزیولوژی ورزش، گروه تربیت‌بدنی و علوم ورزشی دانشکده علوم انسانی، دانشگاه لرستان، خرم‌آباد، ایران
تلفن: 33120328-066، دورنگار: ۳۲۷۲۱۷۲۵-۰۶۶، پست الکترونیکی: fathi.m@lu.ac.ir
 
 
[3]- PhD Student of Exercise Physiology, Dept. of Physical Education & Sport Sciences, Faculty of Physical Education, Shahid Chamran University of Ahvaz, Ahvaz, Iran ORCID: 0000-0003-0413-9803
[4]- Assistant Prof. of Exercise Physiology, Dept. of Physical Education & Sport Sciences, Faculty of Humanities, Lorestan University, Khorramabad, Iran, ORCID: 0000-0002-2113-365X
(Corresponding Author) Tel: (066) 33120328, Fax: (066) 32721725, E-mail: fathi.m@lu.ac.ir
نوع مطالعه: پژوهشي | موضوع مقاله: تربيت بدني
دریافت: ۱۳۹۷/۵/۳ | پذیرش: ۱۳۹۷/۱۲/۲۲

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2019 All Rights Reserved | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb