جلد 18، شماره 3 - ( 3-1398 )                   جلد 18 شماره 3 صفحات 226-209 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Saffari F, Radfar A, Sobhanipoor M H, Ahmadrajabi R. Frequency of Nasal Carriage of Staphylococcus aureus and Associated Risk Factors and Its Antibiotic Susceptibility Pattern Among Healthcare Workers in Pastor and Aflatoonian Hospitals in Bam, Southeast Iran, in 2017: A Cross-Sectional Study. JRUMS 2019; 18 (3) :209-226
URL: http://journal.rums.ac.ir/article-1-4499-fa.html
صفاری فرشته، رادفر علی، سبحانی پور محمدحسین، احمدرجبی رویا. فراوانی حاملین بینی استافیلوکوکوس اورئوس و عوامل مرتبط با حاملی و الگوی حساسیت آنتی‌بیوتیکی آن در پرسنل کادر درمانی بیمارستان‌های پاستور و افلاطونیان شهر بم در سال 1396: یک مطالعه مقطعی. مجله دانشگاه علوم پزشکی رفسنجان. 1398; 18 (3) :209-226

URL: http://journal.rums.ac.ir/article-1-4499-fa.html


گروه میکروبشناسی و ویروس شناسیدانشگاه علوم پزشکی کرمان
متن کامل [PDF 351 kb]   (1252 دریافت)     |   چکیده (HTML)  (2839 مشاهده)
متن کامل:   (1583 مشاهده)
مقاله پژوهشی
مجله دانشگاه علوم پزشکی رفسنجان
دوره 18، خرداد 1398، 226-209
 
 
 
 
 
 
 
 
 
 
فراوانی حاملین بینی استافیلوکوکوس اورئوس و عوامل مرتبط با حاملی و الگوی حساسیت آنتی­بیوتیکی آن در پرسنل کادر درمانی بیمارستان­های پاستور و افلاطونیان شهر بم در سال 1396: یک مطالعه مقطعی
 
 
 
فرشته صفاری[1]، علی رادفر[2]، محمد حسین سبحانی­پور[3]، رویا احمدرجبی[4]،
 
دریافت مقاله: 13/8/97   ارسال مقاله به نویسنده جهت اصلاح: 5/9/97      دریافت اصلاحیه از نویسنده: 28/10/97       پذیرش مقاله: 29/10/97
 
 
 

چکیده
زمینه و هدف: کلونیزاسیون استافیلوکوکوس اورئوس در بینی پرسنل درمانی بیمارستان می­تواند از منابع اصلی عفونت­های بیمارستانی به­شمار آید. هدف از این مطالعه، تعیین شیوع ناقلین بینی استافیلوکوکوس اورئوس در پرسنل درمانی بیمارستان­های پاستور و افلاطونیان شهر بم و الگوی مقاومت آنتی­بیوتیکی آن­ها و تعیین نوع پروتئین استافیلوکوکی و کاست کروموزومی استافیلوکوکی (Staphylococcal Cassette Chromosome mec; SCCmec) ایزوله مقاوم به متی­سیلین بود.
مواد و روش­ها: در این مطالعه مقطعی، سواب بینی از 258 پرسنل درمانی در سال 1396 گرفته شده و تشخیص ایزوله­های استافیلوکوکوس اورئوس حساس و مقاوم به متی­سیلین انجام شد. مقاومت به آنتی­بیوتیک­ها با روش دیسک دیفیوژن انجام شد. واکنش زنجیره­ای پلیمراز (Polymerase chain reaction; PCR) برای تعیین حضور ژن­های nuc،  mecAو  pvlو تعیین نوع SCCmec و spa استفاده شد. از آزمون­های مجذور کای و دقیق فیشر برای تحلیل داده­ها استفاده گردید.
یافته­ها: 37 نفر (3/14 درصد) حامل  استافیلوکوکوس اورئوس بودند و از این تعداد یک مورد (7/2 درصد) را ایزوله مقاوم به متی­سیلین با SCCmec نوع IV و spa نوع t608 تشکیل داد. تمام ایزوله­ها به وانکومایسین، لینزولید و موپیروسین حساس بودند. ژن pvl در 8 ایزوله (2/22 درصد) مشاهده گردید. به جزء در مورد جنس (036/0=P)، ارتباط معنی­دار آماری بین شغل، سن، بخش فعالیت، سابقه خدمت ، سابقه بستری در بیمارستان، مصرف آنتی­بیوتیک و گروه خونی با حاملیت مشاهده نگردید (05/0p>).
نتیجه­گیری: اگرچه با توجه به نتایج، فراوانی ناقلین بینی در پرسنل درمانی بیمارستان­های مورد مطالعه در مقایسه با دیگر مناطق ایران پایین است، غربالگری منظم پرسنل و راه­کارهای مناسب برای حذف باکتری پیشنهاد می­شود.
واژه­های کلیدی:  استافیلوکوکوس اورئوس، مقاومت دارویی، پرسنل بهداشتی، تایپینگ مولکولی، بم
 
مقدمه
استافیلوکوکوس آرئوس که معمولاَ به عنوان بخشی از میکروبیوتای طبیعی بینی، پوست و بخش­های دیگر بدن در نظر گرفته می­شود، یک بیماری­زای فرصت­طلب می­باشد که می­تواند طیف وسیعی از بیماری­ها از عفونت­های جلدی خفیف تا عفونت­های شدید تهدید کننده حیات را در انسان ایجاد کند [1]. این باکتری به صورت بدون علامت در تقریباً 50 درصد افراد سالم جامعه و کارکنان بهداشتی کلونیزه شده [2] و حاملیت بینی استافیلوکوکوس آرئوس به عنوان یک فاکتور خطر برای عفونت­های انسانی محسوب می­شود [1].
استافیلوکوکوس آرئوس توانایی بالایی به اکتساب ژن­های مقاومت به آنتی­بیوتیک را دارد. مقاومت نسبت به متی­سیلین از طریق تولید یک پروتئین اختصاصی اتصالی به پنی­سیلین به نام (Penicillin Binding Protein 2a; PBP2a) ایجاد شده که تمایل اتصالی بسیار ضعیفی به آنتی­بیوتیک­های بتالاکتام دارد. PBP2a توسط ژن mecA رمزگذاری و با کاست بزرگ ژنی متحرک (Staphylococcal Cassette Chromosome mec; SCCmec) حمل می­شود [3].
یکی از روش­های تایپینگ جهت توصیف صفات اختصاصی ژنتیکی استافیلوکوکوس اورئوس­های مقاوم به متی­سیلین (Methicillin-resistant Staphylococcus aureus; MRSA)، تعیین تایپ کاست کروموزومی استافیلوککی mec (Staphylococcal Cassette Chromosome mec; SCCmec) است. نوع  SCCmecها بر اساس نوع آنزیم ریکامبیناز کد شونده توسط ژن­های ccr و کمپلکس­های mecA مشخص می­شود. تاکنون 11 نوع مختلف از Sccmec شناخته شده است که 5 نوع آن (SCCmec I-V) در ایران غالب می­ باشند [4].
یکی دیگر از روش­های تایپینگ مولکولی باکتری،
spa typing می­باشد. ژن spa کدکننده پروتئین A استافیلوکوکوس اورئوس Staphylococcal protein A; spa)) یکی از عوامل متمایز کننده است که دارای ناحیه پلی مورفیسم X با توالی کوتاه می­باشد و مطالعات مختلف الگوهای متنوعی از این ژن راشناسایی کرده­اند [6 ،1].
 با گزارش طغیان­هایی از عفونت با این باکتری از بخش­های مختلف بیمارستان که یکی از مهم­ترین دلایل آن، حضور ناقلین بدون علامت مراقبین بهداشتی می­باشد [6] و با توجه به ویژگی کار مراقبت­های بهداشتی از جمله پرستاری که گه­گاه تماس فیزیکی با بیمار ضرورت پیدا می‌کند و اقدامات احتیاطی استاندارد نیز ممکن است رعایت نگردد و این پرسنل مستعد آلودگی با این باکتری و انتشار بالقوه آن در مراکز مراقبت­های بهداشتی هستند، لذا شناسایی و تعیین تایپ ایزوله­های استافیلوکوکوس آرئوس جدا شده از حاملین بینی برای هر سیستم نظارت بهداشتی بسیار مهم است تا سیستم قادر به استفاده از استراتژی­هایی به منظور کاهش بالقوه انتشار این باکتری و کاهش عفونت‌های بیمارستانی توسط استافیلوکوکوس اورئوس باشد [7].
 علیرغم اهمیت حاملیت با این باکتری، مطالعات کمی در جنوب شرق ایران [9-8] علی­الخصوص در شهرستان بم در این زمینه انجام شده است لذا این مطالعه با هدف تعیین فراوانی حاملین بدون علامت استافیلوکوکوس آرئوس در بیمارستان­های پاستور و افلاطونیان شهر بم (تنها بیمارستان­های جنوب شرق استان کرمان) و هم­چنین تعیین الگوی مقاومت آنتی­بیوتیکی جدایه­های باکتری انجام شده است.
مواد و روش­ها
دراین مطالعه مقطعی طی مدت سه ماه (تیر ماه 1396 الی شهریور ماه 1396) با سرشماری از کلیه پرسنل بیمارستان­های پاستور و افلاطونیان شهر بم که 420 نفر بودند، 258 نفر حاضر به شرکت در پژوهش شدند که بعد از امضاء رضایت­نامه توسط هر شرکت کننده، نمونه­گیری انجام شد.علاوه بر این، این مطالعه دارای کد اخلاق به شماره 003/1397 از کمیته اخلاق دانشگاه علوم پزشکی بم می_باشد. پرسش­نامه­ای مشتمل بر جنس، سن، شغل، بخش محل فعالیت، سابقه خدمت در بیمارستان، سطح تحصیلات (فارغ­التحصیل دانشگاه، دبیرستان یا راهنمایی)، گروه خونی، سابقه بستری شدن در بیمارستان یا درمان با آنتی­بیوتیک در طول سه ماه گذشته توسط هر شرکت کننده تکمیل گردید [10]. نمونه­برداری توسط سواب استریل مرطوب شده با محلول سالین از قسمت قدامی هر دو سوراخ بینی انجام شد. سواب­ها درون محیط انتقالیBrain Heart Infusion (BHI) Broth (های­مدیا، هندوستان) حاوی 5/6 درصد NaCl گذاشته شده و پس از انتقال به آزمایشگاه پس از 36 ساعت نگهداری در دمای 37 درجه سانتی­گراد، روی محیط مانیتول سالت آگار (Conda ،اسپانیا) کشت داده شده و به مدت 24 ساعت گرم­خانه گذاری گردیدند [11].
تشخیص و تأیید قطعی ایزوله­های استافیلوکوکوس اورئوس (یک کلنی در هر پلیت مانیتول سالت آگار) با استفاده از مورفولوژی کلنی، رنگ آمیزی گرم، تست کاتالاز، DNase، کواگولاز اسلایدی و لوله­ای انجام گردید. برای تشخیص دقیق و قطعی ایزوله­های استافیلوکوکوس اورئوس، حضور ژن ترمونوکلئاز ((thermonuclease gene; nuc با روش واکنش زنجیره­ای پلیمراز (Polymerase chain reaction; PCR) و استفاده از پرایمر ذکر شده در جدول یک بررسی گردید [12].
ایزوله­های استافیلوکوکوس آرئوس حساس به متی­سیلین (MSSA) و مقاوم به متی­سیلین (MRSA) به صورت فنوتیپی با روش انتشار دیسک در محیط مولر هینتون آگار با 4 درصد NaCl و با استفاده از آنتی­بیوتیک سفوکسیتین (30 میکروگرم) تهیه شده از شرکت Mast (انگلستان) طبق توصیه­های موسسه استانداردهای آزمایشگاهی و بالینی (Clinical and Laboratory Standards Institute; CLSI) شناسایی شدند [13] . تشخیص ایزوله­های استافیلوکوکوس آرئوس مقاوم به متی­سیلین با روش PCR و شناسایی ژن mecA قطعی شد (جدول یک) [14].
حساسیت جدایه­های استافیلوکوکوس آرئوس نسبت به دیسک­های آنتی­بیوتیکی تهیه شده از شرکت Mast (انگلستان) شامل تری­متوپریم سولفامتاکسازول (1 میکروگرم)، لینزولید (30 میکروگرم)، کلیندامایسین (2 میکروگرم)، موپیروسین (5 میکروگرم)، آمیکاسین (30 میکروگرم) و فوزیدیک اسید (10 میکروگرم) به روش انتشار دیسک و حداقل غلظت مهار کننده وانکومایسین با استفاده از نوار E. test (Liofilchem، ایتالیا) بر اساس استاندارد CLSI تعیین گردید [13].
در ادامه برای استخراج DNA ایزوله­های میکروبی از کیت استخراج DNA (سیناکلون، ایران) مطابق دستورالعمل کیت شرکت سازنده استفاده گردید. کلیه واکنش­های PCR در حجم 25 میکرولیتری با استفاده از کیتTaq DNA Polymerase 2x Master Mix RED شرکت آمپلیکون-دانمارک مطابق با دستورالعمل کیت انجام گرفت. مراحل حرارتی برای انجام واکنش زنجیره­ای پلیمراز هر ژن در دستگاه ترموسایکلر (Gottingen, Biometra-T300) ساخت کشور آلمان، 5 دقیقه در 95 درجه سانتی­گراد برای دناتوراسیون اولیه، 30 سیکل شامل 60 ثانیه در 95 درجه سانتی­گراد برای دناتوراسیون در سیکل­ها، 45 ثانیه در (60 درجه سانتی­گراد برای ژن nuc، 56 درجه سانتی­گراد برای ژن mecA و 54 درجه سانتی­گراد برای ژن pvl) برای اتصال پرایمرهای اختصاصی هر ژن (جدول 1)، 45 ثانیه در 72 درجه سانتی­گراد برای تکثیر قطعه هدف و در نهایت بسط نهایی 10 دقیقه در 72 درجه سانتی­گراد بود [15].
واکنش Multiplex PCR  نیز برای شناسایی تایپ­های SCCmec (تیپ­های I تا V) در حجم 50 میکرولیتری با استفاده از کیت Taq DNA Polymerase 2x Master Mix RED شرکت آمپلیکون- دانمارک مطابق با دستورالعمل کیت انجام گرفت. مخلوط هر واکنش PCR شامل 5/0 میکرولیتر از هر پرایمر (20 پیکومول) (جدول شماره دو) بود. مراحل حرارتی برای انجام PCR در ترموسایکلر شامل 4 دقیقه در 94 درجه سانتی­گراد برای دناتوراسیون اولیه، 30 سیکل شامل 30 ثانیه در 94 درجه سانتی­گراد برای دناتوراسیون در سیکل­ها، 30 ثانیه در 56 درجه سانتی­گراد برای اتصال پرایمرها، 60 ثانیه در 72 درجه سانتی­گراد برای تکثیر قطعه هدف و در نهایت بسط نهایی 4 دقیقه در 72 درجه سانتی­گراد بود [16].
جهت تکثیر ناحیه متغیر X ژن پروتئین A در جدایه MRSA از روش PCR همان­گونه که قبلا توصیف شده است [17] استفاده شد و تعیین  توالی محصول PCR توسط شرکت Bioneer (سئول، کره) با روش خاتمه زنجیره دی دئوکسی با استفاده Biosystems 3730/3730X1 DNA Analyzers (Applied Biosystems, Foster City, CA USA) Applied انجام گرفت. تیپ­بندی ایزوله­ ها بر اساس آنالیز نتایج تعیین ترادف با برنامه  Ridom Staphtype software (version 1.4; Ridom, GmbH, Wurzburg, Germany)  انجام گردید.
بعد از انجام آزمایشات، محصولات ژن spa تعیین توالی شده و تایپ spa مشخص گردید.کلیه داده­ها وارد نرم افزار SPSS نسخه 20 گردید. پس از تعیین فراوانی و توزیع ناقلین، از آزمون­های مجذور کای و دقیق فیشر با در نظر گرفتن سطح معنی­داری 05/0 p< برای بررسی ارتباط بین حاملیت با سایر متغیرها استفاده شد.
 
 
جدول 1- توالی پرایمرهای مورد استفاده در واکنش PCR ژن­های nuc، mecA  وpvl
اندازه محصول PCR (جفت باز) توالی پرایمر (5'¾® 3') نام ژن
287 F- GCGATTGATGGTGATACGGTT
R- AGCCAAGCCTTGACGAACTAAAGC
nuc
286 F- GTAGAAATGACTGAACGTCCGATA
R- CCAATTCCACATTGTTTCGGTCTAA
mecA
150 F- ATCATTAGGTAAAATGTCTGGACATGATCCA
R- GCATCAASTGTATTGGATAGCAAAAGC
pvl
 
جدول 2- توالی پرایمرهای مورد استفاده در Multiplex PCR برای شناسایی تایپ­های SCCmec
 
نام ژن توالی پرایمر (5'¾® 3') اندازه محصولPCR
(جفت باز)
هدف SCCmec type
I II III IV V
β ATTGCCTTGATAATAGCCYTCT 937 ccrA2-B   *   *  
α3 TAAAGGCATCAATGCACAAACACT
 
ccrCF CGTCTATTACAAGATGTTAAGGATAAT 518 ccrC     *   *
ccrCR CCTTTATAGACTGGATTATTCAAAATAT
 
1272F1 GCCACTCATAACATATGGAA 415 IS1272 *     *  
1272R1 CATCCGAGTGAAACCCAAA
 
5RmecA TATACCAAACCCGACAACTAC 359 mecA–IS431         *
5R431 CGGCTACAGTGATAACATCC
 
 
نتایج
در مطالعه حاضر مجموعاً 258 نمونه سواب بینی از پرسنل بیمارستان­های شهر بم شامل 170 نمونه (9/65 درصد) از بیمارستان پاستور و 88 نمونه (1/34 درصد) از بیمارستان افلاطونیان مورد بررسی قرار گرفت. میانگین و انحراف معیار سنی شرکت کنندگان در مطالعه 33/9±83/33 سال (محدوده سنی 18-59 سال) بود. 209 نفر (81 درصد) از جمعیت مورد مطالعه را زنان و 49 نفر (19 درصد) باقی­مانده را مردان تشکیل می­دادند. نتایج حاصل از تست­های بیوشیمیایی و حضور ژن nuc در این مطالعه نشان داد که 37 نفر (3/14 درصد) از کل افراد مورد مطالعه حامل استافیلوکوکوس اورئوس بودند که از این تعداد 12 نفر (4/32 درصد) از حاملین را مردان و 25 نفر (6/67 درصد) را زنان تشکیل می­داد. از این تعداد حاملین، 36 نفر (3/97 درصد) حاملین استافیلوکوکوس اورئوس حساس به متی­سیلین بودند که 22 مورد (1/61 درصد) مربوط به بیمارستان پاستور و 14 مورد (9/38 درصد) مربوط به بیمارستان افلاطونیان بود. تنها یک زن پرستار (7/2 درصد) با سن 35 سال و 13 سال سابقه کار در بخش مراقبت­های ویژه بیمارستان پاستور، حامل استافیلوکوکوس اورئوس مقاوم به متی­سیلین بود که با تست­های فنوتیپی و حضور ژن mecA در آن تأیید و SCCmec تیپ IV در این ایزوله مشخص گردید. این ایزوله دارای spa تایپ t608 بود.
 
 
جدول 3- فراوانی حاملین استافیلوکوکوس اورئوس حساس به متی­سیلین به تفکیک بخش محل کار پرسنل کادر درمانی در بیمارستان­های افلاطونیان و پاستور شهر بم در سال 1396 (258n= )
 
بخش بیمارستان افلاطونیان بیمارستان پاستور (درصد) تعداد
    تعداد نمونه (درصد) تعداد ناقلین تعداد نمونه (درصد) تعداد ناقلین تعداد نمونه (درصد) تعداد ناقلین
اداری 17 (4/29) 5 8 (25) 2 25 (28) 7
داخلی 15 (6/6) 1 12 (3/8) 1 27 (4/7) 2
مراقبت­ های ویژه 0 0 14 0 14 0
اورژانس 9 (1/11) 1 19 (21) 4 28 (8/17) 5
اتاق عمل 8 (25) 2 45 (7/17) 8 53 (9/18) 10
زنان 2 0 2 0 4 0
اطفال 6 (7/16) 1 18 (1/11) 2 24 (5/12) 3
جراحی مردان 5 0 11 (1/9) 1 16 (25/6) 1
جراحی زنان 7 0 10 (10) 1 17 (1/9) 1
مراقبت­های قلبی 6 0 7 (3/14) 1 13 (7/7) 1
اعصاب 0 0 7 0 7 0
زایمان 6 0 15 (20) 3 21 (3/14) 3
آزمایشگاه و رادیولوژی 5 (40) 2 1 0 6 (50) 3
سایر قسمت­ها 2 0 1 0 3 0
آزمون­های مجذور کای و دقیق فیشر، 05/0˂ pاختلاف معنی­دار
 
 
فراوانی ناقلین استافیلوکوکوس اورئوس حساس به متی‌سیلین در پرسنل بهداشتی شاغل در بخش­های مختلف بیمارستان­های شهر بم متفاوت بود. در مجموع آزمایشگاه، بخش اداری و اتاق عمل به ترتیب با 50 درصد، 28 درصد و 9/18 درصد دارای بیش­ترین موارد مثبت حاملیت بودند (جدول 3). صرف نظر از بخش­های زنان، اعصاب، آزمایشگاه، رادیولوژی و سایر قسمت­ها به دلیل فراوانی کوچک در سایر بخش­های مورد مطالعه از لحاظ آماری، اختلاف معنی­داری بین فراوانی حاملیت در بخش­های محل کار افراد مشاهده نگردید (147/0 =p).
در این مطالعه بیش­ترین میزان حاملیت استافیلوکوکوس اورئوس حساس به متی­سیلین در تکنیسین­های آزمایشگاه و رادیولوژیست­ها (3/33 درصد) مشاهده گردید (جدول 4 .(از لحاظ آماری ارتباط معنی­داری بین شغل افراد و حاملیت با استافیلوکوکوس اورئوس مشاهده نگردید (57/0 =p).
 
 
جدول 4- فراوانی حاملین استافیلوکوکوس اورئوس حساس به متی سیلین به تفکیک شغل پرسنل کادر درمانی در بیمارستان­های پاستور و افلاطونیان شهر بم در سال 1396 (258n= )
 
شغل
بیمارستان پاستور بیمارستان افلاطونیان جمع
تعداد نمونه  (درصد) تعداد نمونه تعداد نمونه (درصد) تعداد نمونه تعداد نمونه (درصد) تعداد نمونه
پرستار 74 (4/9) 7 14 0 88 (9/7) 7
بهیار 14 (1/7) 1 15 (3/13) 2 29 (3/10) 3
ماما 17 (5/23) 4 5 0 22 (2/18) 4
پرسنل اتاق عمل 22 (6/13) 3 6 (6/16) 1 28 (3/14) 4
پزشک 8 (5/12) 1 2 (50) 1 10 (20) 2
کارمند 8 (25) 2 17 (4/29) 5 25 (28) 7
تکنیسین آزمایشگاه و رادیولوژیست 1 0 5 (40) 2 6 (3/33) 2
پرسنل خدمات و سایر 26 (4/15) 4 24 (5/12) 3 50 (14) 7
 
آزمون­های مجذور کای و دقیق فیشر، 05/0 p<اختلاف معنی­دار
 
 
میانگین و انحراف معیار سنی افراد سالم 19/9 ±04/34 سال و میانگین و انحراف معیار سنی افراد ناقل استافیلوکوکوس اورئوس حساس به متی­سیلین 82/8 ±55/32 سال بود که بیش­ترین میزان ناقلین در گروه سنی کمتر از 30 سال مشاهده گردید. میانگین مدت حضور پرسنل 9 سال با دامنه 1سال تا 36 سال بود. اختلاف معنی‌داری بین میزان ناقل بودن با در نظر گرفتن گروه سنی خاص، سطح تحصیلات و سابقه کار مشاهده نشد (05/0p<) (جدول 5). در این مطالعه فاکتورهای خطر احتمالی دیگری مرتبط با حاملیت استافیلوکوکوس اورئوس مانند سابقه بستری شدن در بیمارستان، سابقه مصرف آنتی­بیوتیک و گروه خونی بررسی شد و هیچ ارتباط معنی­داری بین این فاکتورها با حاملیت مشاهده نگردید (جدول 5).
نتایج حاصل از بررسی حساسیت آنتی­بیوتیکی نشان داد که کلیه ایزوله­های استافیلوکوکوس اورئوس نسبت به وانکومایسین، لینزولید، موپیروسین، آمی­کاسین، ریفامپین و فوزیدیک اسید حساس بودند. 11 ایزوله (5/30 درصد) نسبت به تری­متو پریم سولفامتاکسازول و 5 ایزوله (14 درصد) به کلیندامایسین مقاوم بودند.
ژن pvl در 8 (2/22 درصد) ایزوله­های استافیلوکوکوس اورئوس حساس به متی­سیلین مشاهده گردید.
 
 
جدول 5- ارتباط فاکتورهای مورد مطالعه با حاملیت استافیلوکوکوس اورئوس حساس به متی­سیلین در پرسنل کادر درمانی در بیمارستان­های پاستور و افلاطونیان شهر بم در سال 1396 (258n= )
p مقدار (درصد) تعداد کشت مثبت (درصد) تعداد متغیر
036/0  
(5/24) 12
(5/11) 24
 
(19) 49
(81) 209
جنس
مرد
زن
 
564/0
 
(16) 17
(9/14) 13
(8/7) 4
(4/15) 2
 
(1/41) 106
(1/34) 88
(8/19) 51
(5) 13
سن (سال)
30  
40-31  
50-41  
60-51  
458/0  
(7/15) 23
(9/12) 12
(5/5) 1
 
(6/56) 146
(4/36) 94
(7) 18
سابقه کار (سال)
9-0  
20-10  
36-21  
986/0  
(2/14) 25
(4/13) 9
(3/14) 2
 
(2/68) 176
(26) 67
(8/5) 15
سطح تحصیلات
دانشگاهی  
دبیرستان  
راهنمایی  
225/0  
 
(4/7) 2
(8/14) 34
 
 
(5/10) 27
(5/89) 231
سابقه بستری در بیمارستان
دارد  
ندارد  
 
405/0
 
 
(5/12) 10
(7/14) 26
 
 
(31) 80
(69) 178
سابقه مصرف آنتی‌بیوتیک
دارد  
ندارد  
807/0  
(7/13) 7
(7/12) 7
(5/17) 7
(3/15) 13
(8/7) 2
 
(8/19) 51
(7/21) 56
(5/15) 40
(33) 85
(10) 26
گروه خونی
A  
B  
AB  
O  
نامشخص  
آزمون­های مجذور کای و دقیق فیشر، 05/0 p<اختلاف معنی­دار
 
بحث
بر اساس دانش ما، شیوع ناقلین بینی استافیلوکوکوس اورئوس حساس و مقاوم به متی­سیلین در بیمارستان­های شهر بم تا این تاریخ گزارش نشده است. بر اساس نتایج به‌دست آمده از مطالعه ما، 37 نفر (3/14 درصد) از پرسنل بیمارستان­های شهر بم حامل استافیلوکوکوس اورئوس حساس به متی­سیلین و 4/0درصد آن­ها حامل استافیلوکوکوس اورئوس مقاوم به متی­ سیلین در بینی خود بودند. در ایران شیوع حاملین استافیلوکوکوس آرئوس بین 7/12 تا 43 درصد گزارش شده است [18].
در مطالعه Askarian و همکاران شیوع ناقلی بینی MRSA را 3/5 درصد و میزان MSSA را 7/25 درصد گزارش کرده که بیش‌ترین فراوانی از بخش­های جراحی و بخش اورژانس گزارش شده است [10]. Sharifi-Mood و همکاران شیوع استافیلوکوکوس اورئوس را در پرسنل بخش مراقبت ویژه بیمارستان­های زاهدان 10 درصد گزارش کرده‌اند که میزان مقاومت به چند دارو پایین بوده است [9]. در مطالعه Afrough و همکاران شیوع سویه­های MRSA 5/52 درصد گزارش شده است [7]. در مطالعه انجام شده بر روی پرسنل بهداشتی یک بیمارستان در نوار غزه 31 درصد حاملین باکتری و 5/25 درصد حامل استافیلوکوکوس اورئوس مقاوم به متی­سیلین گزارش گردیده است [19]. در مطالعه­ای در آرژانتین 30 درصد از پرسنل بهداشتی حاملین این باکتری گزارش شده­اند که 3/6 درصد آن­ها حامل MRSA بوده­اند [20]. مطالعه­ای در پرو توسط Garcia و همکاران 7/22 درصد از پرسنل بهداشتی را حامل استافیلوکوکوس اورئوس و 3/8 درصد آن­ها را حامل MRSA گزارش کرده­اند [21].
در بیمارستان­های مورد مطالعه ما فراوانی MSSA و MRSA مغایر با مطالعات یاد شده و مشابه مطالعه Moradi-Tabriz و همکاران [18] و Ghafouri و همکاران [22] به نسبت پایین بود. گزارشات متفاوت در میزان حاملین استافیلوکوکوس اورئوس ممکن است ناشی از توزیع جغرافیایی متفاوت، اختلاف در طراحی مطالعه و اندازه نمونه مورد پژوهش، شیوه نمونه­گیری، روش شناسایی سویه­های MRSA، تفاوت در رعایت اصول بهداشتی بین پرسنل مورد بررسی و شرایط محیط کار از لحاظ استاندارد­های ایمنی و بهداشتی باشد.
در مطالعه ما بیش­ترین فراوانی حاملیت در تکنیسین­های آزمایشگاه و رادیولوژیست­ها مشاهده گردید که شاید علت آن در معرض قرار­گیری بیش­تر پرسنل با باکتری و تماس نزدیک­تر آنان با بیماران باشد. مشابه مطالعه، Akhtar [23] در پاکستان، در مطالعه ما نیز فراوانی حاملیت در ماماها قابل توجه بود که می­تواند نگران کننده باشد به دلیل این­که این افراد می­توانند به عنوان منبع انتقال باکتری علاوه بر مادر باردار، برای نوزادان تازه متولد شده باشند که سیستم ایمنی به مراتب ضعیف­تری داشته و مستعد کسب عفونت هستند.
در مطالعه حاضر ارتباط بعضی از عوامل خطر با حاملیت مورد بررسی قرار گرفت. در این مطالعه بین حاملین مرد و زن تفاوت معنی­دار آماری مشاهده شد که مشابه با مطالعهAl-Talib  و همکاران در مالزی [24] و مغایر با مطالعه انجام شده توسط Abbasi و همکاران در شهر­کرد می­باشد [25]. هم­چنین مشابه با مطالعه Abbasi و همکاران [25] و مغایر با مطالعه Moradi-Tabriz و همکاران [18] هیچ تفاوت آماری معنی­داری میان شغل پرسنل با فراوانی حاملین بینی استافیلوکوکوس اورئوس مشاهده نشد. در این مطالعه بیشترین موارد حاملیت در پرسنل بخش اورژانس و اتاق عمل مشاهده گردید که از بخش­های شلوغ و پرکار بیمارستان­های مورد مطالعه می­باشند. ارتباط معنی­داری میان بخش­های مختلف بیمارستان با فراوانی حاملین بینی استافیلوکوکوس اورئوس مشاهده نشد که با مطالعه Moradi-Tabriz و همکاران [18] و Abbasi و همکاران هم­خوانی داشته [25]، ولی مغایر با مطالعه  Ziasheykhو همکاران [26] می­باشد.
مشابه با مطالعه Askarian و همکاران [10] ایزوله­های MSSA و MRSA جدا شده در این مطالعه نسبت به کلیه آنتی­بیوتیک­ها به­جزء تری­متوپریم سولفامتاکسازول و کلیندامایسین حساسیت نشان دادند که ممکن است به دلیل تجویز محدود و استفاده از این آنتی­بیوتیک­ها در جامعه مورد مطالعه ما باشد. بنابراین استفاده از آنتی­بیوتیکی مانند وانکومایسین و یا پمادهایی مانند موپیروسین و فوزیدیک اسید شاید بتواند در درمان و پیش­گیری از این باکتری درجامعه مورد مطالعه ما مؤثر باشد.
برای تعیین منشأ ایزوله­های MRSA در کشور و مقایسه با سایر مناطق تعیین تیپSCCmec  بسیار استفاده می­شود. در بین تیپ­های SCCmec، تنها تیپ­هایI-V  گستردگی جهانی داشته و بقیه محدود به مناطق جغرافیایی خاص می‌باشند. در یک مطالعه در ایران از میان انواع SCCmec، نوع SCCmec III به عنوان نوع غالب (48/60 درصد) و بعد نوع IV (2/21 درصد)، نوع I (72/17 درصد)، نوع II (12/17 درصد)، و نوع V (5/0 درصد) گزارش شده است [27]. در تحقیق انجام شده توسط Goudarzi و همکاران غالب­ترین SCCmec جدا شده از بخش مراقبت ویژه مربوط به تیپ IV و در درجه بعدی تیپ  IIIبوده است [28]. در مطالعه Taherirad و همکاران تمام ایزوله­های MRSA جدا شده از پرسنل بهداشتی دارای تیپ III بوده­اند[29]. در مطالعه ما تنها ایزوله  MRSAدارای تیپ IV و جدا شده از بخش مراقبت ویژه بود. این تیپ در MRSA­های کسب شده از جامعه بیش­تر دیده می­شود و در حال حاضر پیشنهاد شده است که جدایه­های MRSA مرتبط با جامعه ممکن است در بیمارستان گسترش یابند [27].
یکی از ویژگی­های ژنتیکی مهم مرتبط با استافیلوکوکوس اورئوس بیان اگزوتوکسینی به نام پنتون والنتین لکوسیدین می­باشد. پنتون والنتین لکوسیدین توسط ژن­هایlukF-PV  و lukS-PV کد­گذاری شده و حضور آن در جدایه­های استافیلوکوکوس اورئوس با نکروز بافت و تخریب لکوسیت­ها از طریق ایجاد منفذ در غشای سلولی همراه است [30]. شیوع ژنpvl  در ایزوله­های استافیلوکوکوس اورئوس مورد مطالعه ما 2/22 درصد بود که بیش­تر از میزان گزارش شده در مطالعه Lari و همکاران (19 درصد) [31] از ایران و کشورهایی مانند چین، ماداگاسکار و کشورهای آفریقایی است [34-32]. سویه­های حاوی ژن pvl دارای توان بالقوه به گسترش اپیدمیولوژیکی بوده وگسترش این سویه­ها از جامعه به بیمارستان گزارش شده است. حضور چنین سویه‌هایی دارای خطراتی برای بیماران بستری و متعاقباً باعث افزایش نگرانی در سیستم بهداشتی خواهد بود.
مطالعات in vitro نشان داده است که آنتی­ژن­های گروه خونی به عنوان لیگاند استافیلوکوکوس اورئوس به­کار می­رود و کلونیزاسیون باکتری را حمایت می­کند. افراد با گروه خونی O در مقایسه با گروه خونی A بیش­تر در معرض خطر حاملیت با استافیلوکوکوس اورئوس بوده­اند [35]. در مطالعه ما ارتباط معنی­داری بین حاملیت و گروه خونی مشاهده نشد.
تعیین سریع و دقیق استافیلوکوکوس اورئوس مختلف جدا شده از بیماران و حاملان کمک بزرگی در شناخت اپیدمیولوژی این باکتری­ها و کنترل عفونت آن­ها می­باشد [4] که در این مطالعه از روش spa typing استفاده گردید.  spaتایپ تنها ایزوله MRSA این مطالعه t608 بود. تایپ­های مختلف spa در نواحی مختلف جهان متفاوت هستند. در چین تایپ t037 [36] و در آلمان تایپ­های t032 و t003 [37] به عنوان غالب­ترین تایپ­ها گزارش شده­اند. در مطالعه­ای در ایران spa تایپ­های t030 و t037 گزارش گردیده­اند [38]. spa تایپ t608 از آلمان [37] و با فراوانی پایین از شمال ایران [4] گزارش گردیده است.
در این مطالعه فقظ تعدادی از فاکتورهای مؤثر در حاملیت استافیلوکوکوس اورئوس برررسی شده است؛ بنابراین پیشنهاد می­شود که ارتباط فاکتورهای دیگر از جمله سابقه استفاده از سیگار، اختلالات بینی (سینوزیت، رینیت آلرژیک، انحراف سپتوم بینی) و سابقه بیماری­های زمینه­ای مانند فشار خون بالا، بیماری­های ایسکمیک قلب، انسدادی مزمن ریوی، و دیابت با حاملیت استافیلوکوکوس اورئوس بررسی شود. از آن­جایی که در این مطالعه فقط یک ایزوله MRSA مشخص گردید و تاکنون هیچ مطالعه­ای در مورد spa تایپ­های استافیلوکوکوس اورئوس مقاوم به متی­سیلین جدا شده از بیماران در بیمارستان­های مورد مطالعه ما انجام نشده است، بنابراین نمی­توان مشخص نمود که آیا این spa تایپ توزیع مشابهی در MRSA های جداشده از پرسنل بهداشتی و بیماران دارد یا خیرکه محدودیتی برای مطالعه ما به شمار می­آید. لذا پیشنهاد می­گردد که توزیع spa تایپ‌های استافیلوکوکوس اورئوس حساس به متی­سیلین جدا شده از پرسنل کادر درمانی و بیماران نیز تعیین گردد. در این مطالعه از دیسک دیفیوژن برای بررسی حساسیت ایزوله­ها به موپیروسین استفاده شده است که پیشنهاد می‌گردد که حداقل غلظت بازدارندگی (Minimum Inhibitory Concentration; MIC) از رشد موپیروسین نیز بررسی شود.
نتیجه‌گیری
مطالعه حاضر نشان داد که فراوانی ناقلین بینی استافیلوکوکوس اورئوس حساس و مقاوم به متی­سیلین به ترتیب 3/14 درصد و 4/0 درصد در پرسنل درمانی پرسنل بیمارستان­های شهر بم می­باشد که در مقایسه با گزارشات از دیگر مناطق ایران، پایین می­باشد. همه ایزوله­ها به موپیروسین حساس بودند، بنابراین شاید بتوان موپیروسین را به عنوان داروی انتخابی برای ریشه­کنی کلونیزاسیون و ناقلیت باکتری در بیمارستان­های مورد مطالعه استفاده نمود.
تشکر و قدردانی
مقاله حاضر حاصل از طرح مصوب معاونت محترم پژوهشی دانشگاه علوم پزشکی بم و با حمایت مالی دانشگاه علوم پزشکی بم می­باشد، لذا محققان برخود لازم می­دانند که از معاونت محترم پژوهشی و هم­چنین از کلیه پرسنل بیمارستان­های پاستور و افلاطونیان شهر بم که در اجرای هر چه بهتر این تحقیق صمیمانه همکاری نمودند، تشکر و قدردانی نمایند.
 
 
 
 
 
References
 
 
[1] Brooks GF, Carroll KC, Butel JS, Morse SA, Mietzner TA. Jawetz. Melnick & Adelberg’s Medical Microbiology. 26th edition. New York. McGraw-Hill Companies 2013; 199-202.
[2] Frank DN, Feazel LM, Bessesen MT, Price CS, Janoff EN, Pace NR. The human nasal microbiota and Staphylococcus aureus carriage. PloS one 2010; 5(5): e10598.
[3] Otter JA, French GL. Molecular epidemiology of community-associated methicillin-resistant Staphylococcus aureus in Europe. Lancet Infect Dis 2010; 10(4): 227-39.
[4] Shakeri F, Ghaemi EA. New Spa types among MRSA and MSSA isolates in north of Iran. Adv Microbiol 2014; 4(13): 899-905.
[5].Silva EC, Samico TM, Cardoso RR, Rabelo MA, Neto B, Monteiro A, et al. Colonization by Staphylococcus aureus among the nursing staff of a teaching hospital in Pernambuco. Rev esc enferm USP 2012; 46(1): 132-7.
[6] Azimian A, Havaei SA, Khosrojerdi M, Naderi M, Samiee S. Isolation of PVL/ACME-positive, community acquired, methicillin-resistant Staphylococcus aureus (USA300) from Iran. JOMMID 2014; 2(3): 100-4.
[7] Afrough P, Pourmand MR, Zeinalinia Z, Yousefi M, Abdossamadi Z, Bagherzadeh Yazdchi S. Molecular typing of clinical and nasal carriage isolates of Staphylococcus aureus by spa gene patterns. J Mazandaran Univ Med Sci 2012; 22(94): 28-34. [Farsi]
[8] Sanadgol N. Methicillin-resistant Staphylococcus aureus in southeast Iran: Herbal control and detection methods comparison. J Med Sci 2014; 14(3): 123-9.
[9] Sharifi-Mood B, Metanat M, Alavi-Naini R, Shakeri A, Bameri Z, Imani M. Nasal carriage of methicillin-resistant staphylococcus aureus among ICU personnel working at Zahedan University, southeastern Iran. Caspian J Intern Med 2013; 4(3): 743-4.
[10] Askarian M, Zeinalzadeh A, Japoni A, Alborzi A, Memish ZA. Prevalence of nasal carriage of methicillin-resistant Staphylococcus aureus and its antibiotic susceptibility pattern in healthcare workers at Namazi Hospital, Shiraz, Iran. Int J Infect Dis 2009; 13(5): e241-7
[11] Lozano C, Gómez-Sanz E, Benito D, Aspiroz C, Zarazaga M, Torres C. Staphylococcus aureus nasal carriage, virulence traits, antibiotic resistance mechanisms and genetic lineages in healthy humans in Spain, with detection of CC398 and CC97 strains. Int J Med Microbiol 2011; 301(6): 500-5.
[12] Ahmadrajabi R, Layegh-Khavidaki S, Kalantar-Neyestanaki D, Fasihi Y. Molecular analysis of immune evasion cluster (IEC) genes and intercellular adhesion gene cluster (ICA) among methicillin-resistant and methicillin-sensitive isolates of Staphylococcus aureus. J Prev Med Public Health 2017; 58(4): E308-14.
[13] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; Twenty-Seventh informational supplement CLSI document M100-S27 Wayne, 2016.
[14] Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, et al. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol 2004; 42(11): 4947–55.
[15] Diep BA, Otto M. The role of virulence determinants in community-associated MRSA pathogenesis. Trends Microbiol 2008; 16(8): 361–9.
[16] Boye K, Bartels MD, Andersen IS, Moller JA, Westh H. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I–V. Clin Microbiol Infect 2007; 13(7): 725–7.
[17] Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, Witte W. Assignment of Staphylococcus isolates to groups by spa typing, SmaI macro restriction analysis, and multilocus sequence typing. J Clin Microbiol 2006; 44(7): 2533–40.
[18] Moradi-Tabriz H, Hadadi A, Sotoudeh-Anvari M, Rahimi-Foroushani A, Soleimani T, Mehdipour-Aghabagher B, et al. Prevalence and antimicrobial susceptibility of Staphylococcus aureus isolated from nasal carriers. J Med Microbiol 2015; 3(3-4): 14-9.
[19] El Aila NA, Al Laham NA, Ayesh BM. Nasal carriage of methicillin resistant Staphylococcus aureus among health care workers at Al Shifa hospital in Gaza Strip. BMC Infect Dis 2017; 17(1): 28.
[20] Boncompain CA, Suárez CA, Morbidoni HR. Staphylococcus aureus nasal carriage in health care workers: First report from a major public hospital in Argentina. Rev Argent Microbiol 2017; 49(2): 125-31.
[21] Garcia C, Acuña-Villaorduña A, Dulanto A, Vandendriessche S, Hallin M, Jacobs J, et al. Dynamics of nasal carriage of methicillin-resistant Staphylococcus aureus among healthcare workers in a tertiary-care hospital in Peru. Eur J Clin Microbiol Infect Dis 2016; 35(1): 89-93.
[22].Ghafouri M, Besharati R, Lashkardoost H, Nojoomi S, Shakeri A, Shahsavand Sh. Prevalence of nasal carrier Staphylococcus aureus and their antibiotic resistance patterns among Health Care Working in Bojnurd Imam Reza Hospital. J North Khorasan Univ Med Sci 2014; 6(1): 111-15
[23] Akhtar N. Staphylococcal nasal carriage of health care workers. J Coll Physicians Surg Pak 2010; 20(7): 439-43.
[24] Al-Talib H, Yean CY, Hasan H, Nik Zuraina NM, Ravichandran M. Methicillin-resistant Staphylococcus aureus nasal carriage among patients and healthcare workers in a hospital in Kelantan, Malaysia. Pol J Microbiol 2013; 62(1): 109-12.
[25] Abbasi S, Khaledi M, Gholipour A, Heydari R. Assessment of the prevalence of Staphylococcus aureus in nose of the surgical staff of Hajar and kashani's Hospital in 2015. J Shahrekord Univ Med Sci 2017; 19(2): 1-5.
[26] Ziasheykh A, Rezaeian M, Tashakori M. Determination of the prevalence of staphylococcus aureus nasal carriers and antibiotic resistance pattern in clinical wards staff of Ali-Ebne Abitaleb hospital, Ghazvin. J Rafsanjan Univ Med Sci 2010; 81(30): 27-36.
[27] Ghasemian A, Mirzaee M. Methicillin-resistant Staphylococcus aureus (MRSA) strains and the Staphylococcal cassette chromosome mec types in Iran. Infect Epidemiol Microbio 2016; 2(3): 31-4.
[28] Goudarzi M, Goudarzi H, Figueiredo AMS, Udo EE, Fazeli M, Asadzadeh M, et al. Molecular characterization of methicillin resistant Staphylococcus aureus strains isolated from intensive care units in Iran: ST22-SCCmec IV/t790 emerges as the major clone. PLoS One 2016; 11(5): e0155529.
[29] Taherirad A, Jahanbakhsh R, Shakeri F, Anvary S, Ghaemi EA. Staphylococcal cassette chromosome mec types among methicillin-resistant Staphylococcus aureus in northern Iran. Jundishapur J Microbiol 2016; 9(8): e33933.
[30] Gelatti LC, Bonamigo RR, Inoue FM, Carmo MS, Becker AP, Castrucci FM, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying SCCmec type IV in southern Brazil. Rev Soc Bras Med Trop 2013; 46(1): 34-8.
[31] Lari AR, Pourmand MR, Ohadian Moghadam S, Abdossamadi Z, Namvar AE, Asghari B. Prevalence of PVL-containing MRSA isolates among hospital staff nasal carriers. Med Lab J 2011; 42(5): 283-6.
[32] Chen B, Dai X, He B, Pan K, Li H, Liu X, et al. Differences in Staphylococcus aureus nasal carriage and molecular characteristics among community residents and healthcare workers at Sun Yat-Sen University, Guangzhou, Southern China. BMC Infect Dis 2015; 15(1): 303.
[33] Hogan B, Rakotozandrindrainy R, Al-Emran H, Dekker D, Hahn A, Jaeger A, et al. Prevalence of nasal colonization by methicillin-sensitive and methicillin-resistant Staphylococcus aureus among healthcare workers and students in Madagascar. BMC Infect Dis 2016; 16(1): 420.
[34] De Boeck H, Vandendriessche S, Hallin M, Batoko B, Alworonga JP, Mapendo B, et al. Staphylococcus aureus nasal carriage among healthcare workers in Kisangani, the Democratic Republic of the Congo. Eur J Clin Microbiol Infect Dis 2015; 34(8): 1567–72.
[35] Nurjadi D, Lependu J, Kremsner PG, Zanger P. Staphylococcus aureus throat carriage is associated with ABO-/secretor status. J Infect 2012; 65(4): 310-7
[36] Chen H, Liu Y, Jiang X, Chen M, Wang H. Rapid change of methicillin resistant Staphylococcus aureus clones in a Chinese tertiary care hospital over a 15-year period. Antimicrob Agents Chemother 2010; 54(5): 1842–7.
[37] Cuny C, Layer F, Werner G, Harmsen D, Daniels-Haardt I, Jurke A, et al. State-wide surveillance of antibiotic resistance patterns
and spa types of methicillin-resistant Staphylococcus aureus from blood cultures in North Rhine-Westphalia, 2011–2013. Clin Microbiol Infect 2015; 21(8):750-7.

 [38] Goudarzi M, Fazeli M, Goudarzi H, Azad M, Seyedjavadi SS. Spa typing of Staphylococcus aureus strains isolated from clinical specimens of patients with nosocomial infections in Tehran, Iran. Jundishapur J Microbiol 2016; 9(7): e35685.

 
Frequency of Nasal Carriage of Staphylococcus aureus and Associated Risk Factors and Its Antibiotic Susceptibility Pattern Among Healthcare Workers in Pastor and Aflatoonian Hospitals in Bam, Southeast Iran, in 2017: A Cross-Sectional Study
 
F. Saffari[5], A. Radfar[6], M. H. Sobhanipoor[7], R. Ahmadrajabi[8]
 
Received: 04/11/2018  Sent for Revision: 26/11/2018    Received Revised Manuscript: 18/01/2019              Accepted: 19/01/2019
 
Background and Objectives: Colonization of Staphylococcus aureus in the nose of healthcare workers (HCWs) can be considered as the main source of nosocomial infections. The aim of this study was to investigate the frequency of S. aureus nasal carriage among HCWs in Pastor and Aflatoonian hospitals in Bam, its antibiotic resistance patterns, and determine Staphylococcal protein A (spa) typing and staphylococcal cassette chromosome mec (SCCmec) typing of methicillin resistant S. aureus isolate.
Materials and Methods: In this cross-sectional study, a total of 258 nasal swabs were collected from HCWs during 2017 and were analyzed to detect methicillin sensitive and resistant S. aureus isolates. Resistance to different antibiotic agents was determined by disk diffusion. The presence of nuc, mecA, pvl genes, and spa and SCCmec types were determined  by polymerase chain reaction technique (PCR). The data were analyzed using chi-square and Fisher's exact tests.
Results: Thirty seven subjects (14.3%) were nasal carrier of S. aureus and one of them (2.7%) was resistant to methicillin with Sccmec type IV and spa type t608. All of isolates were sensitive to vancomycin, linezolid and mupirocin. The pvl gene was found in 8 (22.2%) isolates. Except with regard to gender (p=0.036), occupation, age, hospital ward, years of healthcare service, previous antibiotic therapy during the last three months, hospitalization and blood group were not significantly associated with nasal carriage (p˃ 0.05).
Conclusion: Although according to the results, the frequency of nasal carriage of S. aureus isolates among HCWs at our hospitals compared to the other studies from Iran was low, regular S. aureus carriage screening as well as decolonization strategies is recommended.
Key words: Staphylococcus aureus, Drug resistance, Health personnel, Molecular typing, Bam
 
Funding: This research was funded by Research Council of Bam University of Medical Sciences with the grant Number of 97/96.
Conflict of interest: None declared.
 
Ethical approval: The Ethics Committee of Bam University of Medical Sciences approved the study (IR. MUBAM. REC. 1397.003).
How to cite this article: Saffari F, Radfar A,  Sobhanipoor MH, Ahmadrajabi R. Frequency of Nasal Carriage of Staphylococcus aureus and Associated Risk Factors and Its Antibiotic Susceptibility Pattern Among Healthcare Workers in Pastor and Aflatoonian Hospitals in Bam, Southeast Iran, in 2017: A Cross-Sectional Study. J Rafsanjan Univ Med Sci 2019; 18 (3): 209-26. [Farsi]
 
 
[1] - استادیار گروه میکروب­شناسی و ویروس­شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران
  1. - استادیار بیماری­های عفونی، دانشکده پزشکی، دانشگاه علوم پزشکی بم، بم، ایران
  1. - دانشجوی دکترای میکروب­شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران
[4] - (نویسنده مسئول) استادیار گروه میکروب­شناسی و ویروس­شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران
تلفن: 33257665-034، دورنگار: 33257665-034، پست الکترونیکی: ahmadrajabi3 @yahoo.com
 
[5]- Assistant Prof., Dept. of Microbiology and Virology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran, ORCID: 0000-0001-7281-7077
[6]- Assistant Prof. of Infectious Diseases, School of Medicine, Bam University of Medical Sciences, Bam, Iran, ORCID: 0000- 0002-8507-7415
[7]- PhD Student of Microbiology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran, ORCID: 0000-0002-7670-4325
[8]- Assistant Prof., Dept. of Microbiology and Virology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran, ORCID: 0000-0001-5636-7037
(Corresponding Author) Tel: (034)33257665, Fax: (034) 33257665, E-mail: ahmadrajabi3 @yahoo.com
نوع مطالعه: پژوهشي | موضوع مقاله: ميكروبيولوژي
دریافت: 1397/8/8 | پذیرش: 1397/10/29 | انتشار: 1398/3/25

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی رفسنجان می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2024 CC BY-NC 4.0 | Journal of Rafsanjan University of Medical Sciences

Designed & Developed by : Yektaweb